ID: 1060514644

View in Genome Browser
Species Human (GRCh38)
Location 9:124258129-124258151
Sequence CCCGGAGAAGGGCGGGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 0, 2: 9, 3: 49, 4: 528}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060514625_1060514644 12 Left 1060514625 9:124258094-124258116 CCTGGGGCTGGGGCCGGGCCGGT 0: 1
1: 0
2: 4
3: 64
4: 724
Right 1060514644 9:124258129-124258151 CCCGGAGAAGGGCGGGGGCCGGG 0: 1
1: 0
2: 9
3: 49
4: 528
1060514619_1060514644 23 Left 1060514619 9:124258083-124258105 CCGGTGAGTCGCCTGGGGCTGGG 0: 1
1: 0
2: 4
3: 28
4: 291
Right 1060514644 9:124258129-124258151 CCCGGAGAAGGGCGGGGGCCGGG 0: 1
1: 0
2: 9
3: 49
4: 528
1060514632_1060514644 -6 Left 1060514632 9:124258112-124258134 CCGGTGGGGCCCCGCGGCCCGGA 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1060514644 9:124258129-124258151 CCCGGAGAAGGGCGGGGGCCGGG 0: 1
1: 0
2: 9
3: 49
4: 528
1060514614_1060514644 30 Left 1060514614 9:124258076-124258098 CCGCGCGCCGGTGAGTCGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 35
Right 1060514644 9:124258129-124258151 CCCGGAGAAGGGCGGGGGCCGGG 0: 1
1: 0
2: 9
3: 49
4: 528
1060514630_1060514644 -1 Left 1060514630 9:124258107-124258129 CCGGGCCGGTGGGGCCCCGCGGC 0: 1
1: 1
2: 5
3: 45
4: 305
Right 1060514644 9:124258129-124258151 CCCGGAGAAGGGCGGGGGCCGGG 0: 1
1: 0
2: 9
3: 49
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060514644 Original CRISPR CCCGGAGAAGGGCGGGGGCC GGG Intronic