ID: 1060514646

View in Genome Browser
Species Human (GRCh38)
Location 9:124258132-124258154
Sequence GGAGAAGGGCGGGGGCCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1690
Summary {0: 1, 1: 0, 2: 15, 3: 145, 4: 1529}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060514619_1060514646 26 Left 1060514619 9:124258083-124258105 CCGGTGAGTCGCCTGGGGCTGGG 0: 1
1: 0
2: 4
3: 28
4: 291
Right 1060514646 9:124258132-124258154 GGAGAAGGGCGGGGGCCGGGCGG 0: 1
1: 0
2: 15
3: 145
4: 1529
1060514632_1060514646 -3 Left 1060514632 9:124258112-124258134 CCGGTGGGGCCCCGCGGCCCGGA 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1060514646 9:124258132-124258154 GGAGAAGGGCGGGGGCCGGGCGG 0: 1
1: 0
2: 15
3: 145
4: 1529
1060514630_1060514646 2 Left 1060514630 9:124258107-124258129 CCGGGCCGGTGGGGCCCCGCGGC 0: 1
1: 1
2: 5
3: 45
4: 305
Right 1060514646 9:124258132-124258154 GGAGAAGGGCGGGGGCCGGGCGG 0: 1
1: 0
2: 15
3: 145
4: 1529
1060514625_1060514646 15 Left 1060514625 9:124258094-124258116 CCTGGGGCTGGGGCCGGGCCGGT 0: 1
1: 0
2: 4
3: 64
4: 724
Right 1060514646 9:124258132-124258154 GGAGAAGGGCGGGGGCCGGGCGG 0: 1
1: 0
2: 15
3: 145
4: 1529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060514646 Original CRISPR GGAGAAGGGCGGGGGCCGGG CGG Intronic