ID: 1060514647

View in Genome Browser
Species Human (GRCh38)
Location 9:124258135-124258157
Sequence GAAGGGCGGGGGCCGGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1745
Summary {0: 1, 1: 0, 2: 15, 3: 179, 4: 1550}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060514635_1060514647 -9 Left 1060514635 9:124258121-124258143 CCCCGCGGCCCGGAGAAGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1060514647 9:124258135-124258157 GAAGGGCGGGGGCCGGGCGGCGG 0: 1
1: 0
2: 15
3: 179
4: 1550
1060514630_1060514647 5 Left 1060514630 9:124258107-124258129 CCGGGCCGGTGGGGCCCCGCGGC 0: 1
1: 1
2: 5
3: 45
4: 305
Right 1060514647 9:124258135-124258157 GAAGGGCGGGGGCCGGGCGGCGG 0: 1
1: 0
2: 15
3: 179
4: 1550
1060514619_1060514647 29 Left 1060514619 9:124258083-124258105 CCGGTGAGTCGCCTGGGGCTGGG 0: 1
1: 0
2: 4
3: 28
4: 291
Right 1060514647 9:124258135-124258157 GAAGGGCGGGGGCCGGGCGGCGG 0: 1
1: 0
2: 15
3: 179
4: 1550
1060514632_1060514647 0 Left 1060514632 9:124258112-124258134 CCGGTGGGGCCCCGCGGCCCGGA 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1060514647 9:124258135-124258157 GAAGGGCGGGGGCCGGGCGGCGG 0: 1
1: 0
2: 15
3: 179
4: 1550
1060514637_1060514647 -10 Left 1060514637 9:124258122-124258144 CCCGCGGCCCGGAGAAGGGCGGG 0: 1
1: 0
2: 0
3: 26
4: 239
Right 1060514647 9:124258135-124258157 GAAGGGCGGGGGCCGGGCGGCGG 0: 1
1: 0
2: 15
3: 179
4: 1550
1060514625_1060514647 18 Left 1060514625 9:124258094-124258116 CCTGGGGCTGGGGCCGGGCCGGT 0: 1
1: 0
2: 4
3: 64
4: 724
Right 1060514647 9:124258135-124258157 GAAGGGCGGGGGCCGGGCGGCGG 0: 1
1: 0
2: 15
3: 179
4: 1550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060514647 Original CRISPR GAAGGGCGGGGGCCGGGCGG CGG Intronic