ID: 1060514648

View in Genome Browser
Species Human (GRCh38)
Location 9:124258136-124258158
Sequence AAGGGCGGGGGCCGGGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1007
Summary {0: 1, 1: 0, 2: 1, 3: 90, 4: 915}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060514632_1060514648 1 Left 1060514632 9:124258112-124258134 CCGGTGGGGCCCCGCGGCCCGGA 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1060514648 9:124258136-124258158 AAGGGCGGGGGCCGGGCGGCGGG 0: 1
1: 0
2: 1
3: 90
4: 915
1060514639_1060514648 -10 Left 1060514639 9:124258123-124258145 CCGCGGCCCGGAGAAGGGCGGGG 0: 1
1: 0
2: 0
3: 34
4: 290
Right 1060514648 9:124258136-124258158 AAGGGCGGGGGCCGGGCGGCGGG 0: 1
1: 0
2: 1
3: 90
4: 915
1060514637_1060514648 -9 Left 1060514637 9:124258122-124258144 CCCGCGGCCCGGAGAAGGGCGGG 0: 1
1: 0
2: 0
3: 26
4: 239
Right 1060514648 9:124258136-124258158 AAGGGCGGGGGCCGGGCGGCGGG 0: 1
1: 0
2: 1
3: 90
4: 915
1060514625_1060514648 19 Left 1060514625 9:124258094-124258116 CCTGGGGCTGGGGCCGGGCCGGT 0: 1
1: 0
2: 4
3: 64
4: 724
Right 1060514648 9:124258136-124258158 AAGGGCGGGGGCCGGGCGGCGGG 0: 1
1: 0
2: 1
3: 90
4: 915
1060514630_1060514648 6 Left 1060514630 9:124258107-124258129 CCGGGCCGGTGGGGCCCCGCGGC 0: 1
1: 1
2: 5
3: 45
4: 305
Right 1060514648 9:124258136-124258158 AAGGGCGGGGGCCGGGCGGCGGG 0: 1
1: 0
2: 1
3: 90
4: 915
1060514619_1060514648 30 Left 1060514619 9:124258083-124258105 CCGGTGAGTCGCCTGGGGCTGGG 0: 1
1: 0
2: 4
3: 28
4: 291
Right 1060514648 9:124258136-124258158 AAGGGCGGGGGCCGGGCGGCGGG 0: 1
1: 0
2: 1
3: 90
4: 915
1060514635_1060514648 -8 Left 1060514635 9:124258121-124258143 CCCCGCGGCCCGGAGAAGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1060514648 9:124258136-124258158 AAGGGCGGGGGCCGGGCGGCGGG 0: 1
1: 0
2: 1
3: 90
4: 915

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060514648 Original CRISPR AAGGGCGGGGGCCGGGCGGC GGG Intronic