ID: 1060514654

View in Genome Browser
Species Human (GRCh38)
Location 9:124258161-124258183
Sequence CGTCACCCCCAGCCGGGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 152}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060514635_1060514654 17 Left 1060514635 9:124258121-124258143 CCCCGCGGCCCGGAGAAGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1060514654 9:124258161-124258183 CGTCACCCCCAGCCGGGCCGAGG 0: 1
1: 0
2: 2
3: 8
4: 152
1060514639_1060514654 15 Left 1060514639 9:124258123-124258145 CCGCGGCCCGGAGAAGGGCGGGG 0: 1
1: 0
2: 0
3: 34
4: 290
Right 1060514654 9:124258161-124258183 CGTCACCCCCAGCCGGGCCGAGG 0: 1
1: 0
2: 2
3: 8
4: 152
1060514643_1060514654 9 Left 1060514643 9:124258129-124258151 CCCGGAGAAGGGCGGGGGCCGGG 0: 1
1: 1
2: 9
3: 90
4: 672
Right 1060514654 9:124258161-124258183 CGTCACCCCCAGCCGGGCCGAGG 0: 1
1: 0
2: 2
3: 8
4: 152
1060514632_1060514654 26 Left 1060514632 9:124258112-124258134 CCGGTGGGGCCCCGCGGCCCGGA 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1060514654 9:124258161-124258183 CGTCACCCCCAGCCGGGCCGAGG 0: 1
1: 0
2: 2
3: 8
4: 152
1060514637_1060514654 16 Left 1060514637 9:124258122-124258144 CCCGCGGCCCGGAGAAGGGCGGG 0: 1
1: 0
2: 0
3: 26
4: 239
Right 1060514654 9:124258161-124258183 CGTCACCCCCAGCCGGGCCGAGG 0: 1
1: 0
2: 2
3: 8
4: 152
1060514645_1060514654 8 Left 1060514645 9:124258130-124258152 CCGGAGAAGGGCGGGGGCCGGGC 0: 1
1: 0
2: 3
3: 42
4: 420
Right 1060514654 9:124258161-124258183 CGTCACCCCCAGCCGGGCCGAGG 0: 1
1: 0
2: 2
3: 8
4: 152
1060514650_1060514654 -9 Left 1060514650 9:124258147-124258169 CCGGGCGGCGGGGCCGTCACCCC 0: 1
1: 0
2: 2
3: 32
4: 477
Right 1060514654 9:124258161-124258183 CGTCACCCCCAGCCGGGCCGAGG 0: 1
1: 0
2: 2
3: 8
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060514654 Original CRISPR CGTCACCCCCAGCCGGGCCG AGG Intronic