ID: 1060515269

View in Genome Browser
Species Human (GRCh38)
Location 9:124261724-124261746
Sequence ACCGAAGGACACTGGCAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060515269_1060515277 -8 Left 1060515269 9:124261724-124261746 CCCCCCTGCCAGTGTCCTTCGGT 0: 1
1: 0
2: 0
3: 5
4: 123
Right 1060515277 9:124261739-124261761 CCTTCGGTGTTGAAAGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060515269 Original CRISPR ACCGAAGGACACTGGCAGGG GGG (reversed) Intronic
902332280 1:15736461-15736483 ACAGAAGGCCACTGGCCCGGAGG + Exonic
902894454 1:19469185-19469207 ACAGAAAGACACAGGCAGGAGGG + Intronic
903404712 1:23086687-23086709 AGTGAAGGAGAATGGCAGGGAGG + Exonic
904053601 1:27655935-27655957 ACAAAAGGACCCTGGCCGGGGGG + Intergenic
908013151 1:59803779-59803801 GCCGAAGGACAATGAGAGGGTGG + Intergenic
910025658 1:82647886-82647908 AGCGAAAGACACTGTCAGAGAGG + Intergenic
917241019 1:172948870-172948892 AACAAAGGACACTGGAAAGGGGG + Intergenic
920087811 1:203430638-203430660 ACCCAAGGCCACTGGGTGGGAGG - Intergenic
920255319 1:204650517-204650539 AGGGAAGAACACTGGCAGAGAGG + Intronic
924477892 1:244397415-244397437 ACCTAAGGAAACTGACAGGGTGG - Intergenic
1067406813 10:46030748-46030770 ACTAAAGGACACTGCAAGGGCGG - Intergenic
1071018147 10:81021811-81021833 AAGGAAGGACACAGGCTGGGTGG + Intergenic
1071676429 10:87659919-87659941 ACCGAAGGACGCAGGGACGGCGG - Exonic
1075810562 10:125221970-125221992 ACAGAAGGTCACTGACAAGGAGG - Intergenic
1076526915 10:131117694-131117716 TCCGAACCACACGGGCAGGGAGG + Intronic
1079492987 11:21010371-21010393 AGAGAAGGAGACAGGCAGGGAGG - Intronic
1081778848 11:45695972-45695994 GCTGAAGGACACTGTCAGAGAGG - Intergenic
1083945622 11:65921144-65921166 ACCCACGGGCCCTGGCAGGGTGG - Intronic
1086093200 11:83024395-83024417 TCCAGAGGGCACTGGCAGGGTGG - Intronic
1088933418 11:114375393-114375415 AATGAAGGAAACTGGCAGGTTGG + Intergenic
1088969812 11:114762879-114762901 ACTGATGGACACTGGCTTGGGGG - Intergenic
1090268839 11:125371540-125371562 AACGAAGGAGACTGGAGGGGAGG - Intronic
1090927445 11:131260994-131261016 ACAGAAGCACACGAGCAGGGTGG - Intergenic
1097247216 12:57613181-57613203 TATGAAGGACACTGGCAGAGAGG + Intronic
1101808993 12:108091663-108091685 ACTGAAGAAGACTGGCAGAGAGG + Intergenic
1102047808 12:109840737-109840759 ATTGAAGGTCCCTGGCAGGGTGG - Intergenic
1103517734 12:121518448-121518470 ACCGAAGCAGGCTGGCAGCGGGG - Intronic
1103699618 12:122842191-122842213 ACGGACGGACGCTGGCAGAGCGG - Intronic
1107836519 13:44416253-44416275 AGCCATGGACACTGGCAGGAGGG - Intergenic
1108533672 13:51349731-51349753 ACTGAAAAACACTGGCAGGCAGG + Intronic
1112205451 13:97319486-97319508 ACAGAGGGACAGTGGTAGGGAGG - Intronic
1118694610 14:68372016-68372038 TGCAAAGGAGACTGGCAGGGAGG + Intronic
1119523965 14:75307599-75307621 ACCGAGGGTGACCGGCAGGGTGG + Intergenic
1121006369 14:90493170-90493192 CCCCCAGGACCCTGGCAGGGAGG - Intergenic
1121564247 14:94896704-94896726 ACTGCAGGAGAGTGGCAGGGTGG - Intergenic
1121614625 14:95304879-95304901 ACCTAAAGATACTGGCATGGGGG + Intronic
1122369936 14:101224007-101224029 ACCGAAGAACAGAGGCAGGAAGG + Intergenic
1128346920 15:66859875-66859897 AGGGAAGGACAGGGGCAGGGTGG - Intergenic
1129113796 15:73353736-73353758 GCCCCAGGACACAGGCAGGGAGG - Intronic
1130366361 15:83243373-83243395 ATGGAAGGATGCTGGCAGGGTGG + Intergenic
1130882851 15:88070058-88070080 ACTGAAGGATGCTGGCAGGAAGG - Intronic
1132365200 15:101251820-101251842 GCCGGAGGACGCGGGCAGGGCGG - Exonic
1132552234 16:558309-558331 CCGGAAGGACTCTGGCAGGGAGG - Intergenic
1133385136 16:5363712-5363734 ACCCAAGGACACTGACTTGGGGG - Intergenic
1138655149 16:58487115-58487137 ACAGAAGGGCACGTGCAGGGAGG - Intronic
1141413679 16:83853969-83853991 CCCGGAGGAGACGGGCAGGGAGG - Intergenic
1142233693 16:88911500-88911522 TCTGAAGGACAGGGGCAGGGAGG + Intronic
1142436031 16:90058032-90058054 ACCAAAGGACACACACAGGGGGG - Exonic
1142909098 17:3071866-3071888 AGCGAAGGGCACTGGGAAGGAGG + Intergenic
1142925463 17:3232372-3232394 AGCGAAGGGCACTGGGAAGGAGG - Intergenic
1143772156 17:9175634-9175656 ACCCAGGGTCACTGGGAGGGTGG + Intronic
1144674742 17:17154538-17154560 ACAGAAGGACACAGGAAGGAAGG - Intronic
1148047437 17:44752910-44752932 ACCAAGGGACACTGCCAGGTGGG - Intergenic
1151963040 17:77417398-77417420 GCCGATGGACCCTGGCAGAGGGG + Intronic
1152080471 17:78184250-78184272 ACCGAAGGCCACACGCCGGGTGG + Intronic
1152728850 17:81960327-81960349 ACCGAAGGACGCCAGCAGAGCGG + Intronic
1154087924 18:11325296-11325318 ACAGTGGGACGCTGGCAGGGTGG + Intergenic
1157566656 18:48683119-48683141 ACCGAAGCACACTGGGTGGCAGG + Intronic
1159150717 18:64519740-64519762 ACAGAATGAAACTGGCAGTGAGG - Intergenic
1159619717 18:70623276-70623298 ACAGATGGACACTGGCATGATGG - Intergenic
1160534803 18:79586108-79586130 AGCAGAGGACACAGGCAGGGAGG - Intergenic
1162043809 19:7985731-7985753 CAGGAAGGAGACTGGCAGGGAGG + Intronic
1163533483 19:17863907-17863929 ACAGAAGGACTCAGCCAGGGTGG - Intronic
1164751269 19:30656765-30656787 ACCTAATGACACTGGCTTGGTGG - Intronic
1165785164 19:38457422-38457444 ACAGAAGAACCCTGGGAGGGAGG - Intronic
1166060601 19:40323206-40323228 AGAGCAGGACACTGGCAGGCAGG + Intronic
927973860 2:27323116-27323138 TCCGAAGGACGCTGGGAGGAAGG - Intronic
930651622 2:53970350-53970372 CCCGTAGGAAAGTGGCAGGGAGG + Intronic
931125128 2:59266829-59266851 AGCAAAGGAAACTGGCAGAGGGG - Intergenic
937307472 2:120881353-120881375 GGAGAAGGACAGTGGCAGGGAGG + Intronic
938215083 2:129504548-129504570 ACTGAAAGACATTGGCAAGGTGG - Intergenic
940290760 2:152075554-152075576 CCTGAAGGACACGGGCAGTGTGG + Intronic
946301724 2:218828137-218828159 GCACAAGGACACTGGCAGGGTGG - Intronic
948122325 2:235540061-235540083 ACAGATGGACAGTGGCAGGTGGG + Intronic
948211004 2:236193186-236193208 CCCGGAGGACACCGGCAGGATGG - Intergenic
948947640 2:241229164-241229186 ACCAAGGGAAACTGGCAGGAGGG + Exonic
1168968831 20:1916930-1916952 ACCGCTGGACATAGGCAGGGAGG + Intronic
1174298413 20:49565226-49565248 AAAGAAGGACAATGGCCGGGAGG - Intronic
1176409001 21:6437602-6437624 GGGGGAGGACACTGGCAGGGAGG - Intergenic
1179684494 21:43045924-43045946 GGGGGAGGACACTGGCAGGGAGG - Intergenic
1181869405 22:25886055-25886077 ACCGAAGGACACCAGCCAGGTGG - Intronic
1182267042 22:29125187-29125209 CCTGAAGGAGCCTGGCAGGGTGG - Intronic
950106394 3:10391712-10391734 ACCGGAGGACAGAGGGAGGGAGG - Intronic
954228862 3:49200622-49200644 AGGGAAGGGCCCTGGCAGGGTGG - Intronic
956400417 3:68873617-68873639 ACCACAGGACACTTGCAGGGAGG + Intronic
961736682 3:129006175-129006197 ATCGAAGCACACAGGCAGTGGGG - Intronic
962080631 3:132135861-132135883 TCAGAAGGCCACTGGCAAGGGGG - Intronic
962220405 3:133560088-133560110 ACCAGAGGACACTAGCAGAGGGG + Intergenic
964055506 3:152451442-152451464 ACTGAAGGACAGAGGAAGGGAGG - Intronic
968291693 3:197544172-197544194 ACAGAAGGAGGCTGGCATGGTGG - Intronic
969702215 4:8773873-8773895 AGCGCAGGACGCTGGGAGGGTGG - Intergenic
970636938 4:18021057-18021079 ACCCACGGGCACTCGCAGGGCGG - Intronic
976667826 4:87618466-87618488 ACCTAAGGACACTTGCATAGAGG - Intergenic
980286362 4:130783035-130783057 ACCGACAGACACTGGCAGGTCGG + Intergenic
986128379 5:4904836-4904858 ACAGGAGGACACTAGCTGGGTGG + Intergenic
986273900 5:6257058-6257080 ACAGAGGGACACTGGAAGGAAGG - Intergenic
989793681 5:45439830-45439852 ATTGAAGGAGACTGGCAGGAAGG + Intronic
1000895435 5:166849308-166849330 ACCCAATGAGAGTGGCAGGGTGG + Intergenic
1003143653 6:3492102-3492124 ACTGAACGGCACTGTCAGGGAGG + Intergenic
1003361043 6:5425529-5425551 AGCCAGGGACACTTGCAGGGCGG - Intronic
1005375621 6:25179531-25179553 AGGAAAGGACACTGGGAGGGTGG - Intergenic
1006233513 6:32606534-32606556 AGTGAAGGACACTGGAAGCGGGG + Intergenic
1010700395 6:79037690-79037712 ACCGAAGTACAGTAGCAGAGAGG + Intronic
1019124201 6:169828329-169828351 GCCCAAAGACACAGGCAGGGAGG - Intergenic
1019775335 7:2909246-2909268 ACCTCTGGACACGGGCAGGGTGG - Intronic
1022954030 7:35364905-35364927 ACTTAAGGTAACTGGCAGGGAGG + Intergenic
1027778328 7:82493151-82493173 AAAAAAGGACACTGGCAAGGTGG - Intergenic
1029546467 7:101212845-101212867 ACCGGAGGACACTCCCGGGGGGG - Exonic
1029996604 7:105013501-105013523 CCCGAAGCACGGTGGCAGGGAGG + Intergenic
1035364919 7:158342913-158342935 AGCGAAGGAGAACGGCAGGGTGG + Intronic
1035567596 8:651657-651679 AGCGAGGGAGACGGGCAGGGTGG + Intronic
1043068873 8:75612935-75612957 ACCTCAGGAAACTGGCATGGTGG + Intergenic
1043383245 8:79724873-79724895 ACCAAAGAGCAATGGCAGGGTGG - Intergenic
1046590557 8:116200874-116200896 AGCGAATGACAATGGCAGAGTGG + Intergenic
1046742776 8:117846537-117846559 ACCTGAGTACAGTGGCAGGGAGG + Intronic
1047135725 8:122075983-122076005 ACTGAGTGACACAGGCAGGGAGG + Intergenic
1048083000 8:131148987-131149009 ACCAATAGACACTGGCAGGTTGG - Intergenic
1055805345 9:80086971-80086993 GCCGGGAGACACTGGCAGGGTGG + Intergenic
1060227979 9:121807750-121807772 ACGGGAGGACAGGGGCAGGGTGG + Intergenic
1060515269 9:124261724-124261746 ACCGAAGGACACTGGCAGGGGGG - Intronic
1060556683 9:124511631-124511653 ACCCAGGGGCTCTGGCAGGGTGG - Intergenic
1061954294 9:133953576-133953598 CCAGAGGGACCCTGGCAGGGTGG + Intronic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1186924806 X:14321922-14321944 ACCGAAGGAAAATAGAAGGGAGG - Intergenic
1188340194 X:28990643-28990665 ACAGACGGTCACTGGCAGAGTGG - Intronic
1189418149 X:40832702-40832724 ACAGAACGTCACTGGCGGGGTGG + Intergenic
1191673851 X:63774409-63774431 AACACAGGACACTGGCAGAGTGG - Intronic
1197073708 X:122330896-122330918 ACAGAAGGAGACAGGGAGGGAGG + Intergenic
1198515837 X:137405892-137405914 AGGGAGGGACACTGGCAGCGCGG + Intergenic