ID: 1060515778

View in Genome Browser
Species Human (GRCh38)
Location 9:124264860-124264882
Sequence TCAGGGAAAGCTCTGATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060515778_1060515789 21 Left 1060515778 9:124264860-124264882 CCTGGCATCAGAGCTTTCCCTGA No data
Right 1060515789 9:124264904-124264926 CGTGAGCTCCGGGGAGGCGAAGG No data
1060515778_1060515791 23 Left 1060515778 9:124264860-124264882 CCTGGCATCAGAGCTTTCCCTGA No data
Right 1060515791 9:124264906-124264928 TGAGCTCCGGGGAGGCGAAGGGG No data
1060515778_1060515786 11 Left 1060515778 9:124264860-124264882 CCTGGCATCAGAGCTTTCCCTGA No data
Right 1060515786 9:124264894-124264916 GGATGAGGAACGTGAGCTCCGGG No data
1060515778_1060515783 -4 Left 1060515778 9:124264860-124264882 CCTGGCATCAGAGCTTTCCCTGA No data
Right 1060515783 9:124264879-124264901 CTGAAAGGCCACTAAGGATGAGG No data
1060515778_1060515788 15 Left 1060515778 9:124264860-124264882 CCTGGCATCAGAGCTTTCCCTGA No data
Right 1060515788 9:124264898-124264920 GAGGAACGTGAGCTCCGGGGAGG No data
1060515778_1060515792 24 Left 1060515778 9:124264860-124264882 CCTGGCATCAGAGCTTTCCCTGA No data
Right 1060515792 9:124264907-124264929 GAGCTCCGGGGAGGCGAAGGGGG No data
1060515778_1060515790 22 Left 1060515778 9:124264860-124264882 CCTGGCATCAGAGCTTTCCCTGA No data
Right 1060515790 9:124264905-124264927 GTGAGCTCCGGGGAGGCGAAGGG No data
1060515778_1060515780 -10 Left 1060515778 9:124264860-124264882 CCTGGCATCAGAGCTTTCCCTGA No data
Right 1060515780 9:124264873-124264895 CTTTCCCTGAAAGGCCACTAAGG No data
1060515778_1060515787 12 Left 1060515778 9:124264860-124264882 CCTGGCATCAGAGCTTTCCCTGA No data
Right 1060515787 9:124264895-124264917 GATGAGGAACGTGAGCTCCGGGG No data
1060515778_1060515785 10 Left 1060515778 9:124264860-124264882 CCTGGCATCAGAGCTTTCCCTGA No data
Right 1060515785 9:124264893-124264915 AGGATGAGGAACGTGAGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060515778 Original CRISPR TCAGGGAAAGCTCTGATGCC AGG (reversed) Intronic