ID: 1060515781

View in Genome Browser
Species Human (GRCh38)
Location 9:124264877-124264899
Sequence TCATCCTTAGTGGCCTTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060515781_1060515787 -5 Left 1060515781 9:124264877-124264899 CCCTGAAAGGCCACTAAGGATGA No data
Right 1060515787 9:124264895-124264917 GATGAGGAACGTGAGCTCCGGGG No data
1060515781_1060515786 -6 Left 1060515781 9:124264877-124264899 CCCTGAAAGGCCACTAAGGATGA No data
Right 1060515786 9:124264894-124264916 GGATGAGGAACGTGAGCTCCGGG No data
1060515781_1060515785 -7 Left 1060515781 9:124264877-124264899 CCCTGAAAGGCCACTAAGGATGA No data
Right 1060515785 9:124264893-124264915 AGGATGAGGAACGTGAGCTCCGG No data
1060515781_1060515791 6 Left 1060515781 9:124264877-124264899 CCCTGAAAGGCCACTAAGGATGA No data
Right 1060515791 9:124264906-124264928 TGAGCTCCGGGGAGGCGAAGGGG No data
1060515781_1060515790 5 Left 1060515781 9:124264877-124264899 CCCTGAAAGGCCACTAAGGATGA No data
Right 1060515790 9:124264905-124264927 GTGAGCTCCGGGGAGGCGAAGGG No data
1060515781_1060515789 4 Left 1060515781 9:124264877-124264899 CCCTGAAAGGCCACTAAGGATGA No data
Right 1060515789 9:124264904-124264926 CGTGAGCTCCGGGGAGGCGAAGG No data
1060515781_1060515792 7 Left 1060515781 9:124264877-124264899 CCCTGAAAGGCCACTAAGGATGA No data
Right 1060515792 9:124264907-124264929 GAGCTCCGGGGAGGCGAAGGGGG No data
1060515781_1060515788 -2 Left 1060515781 9:124264877-124264899 CCCTGAAAGGCCACTAAGGATGA No data
Right 1060515788 9:124264898-124264920 GAGGAACGTGAGCTCCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060515781 Original CRISPR TCATCCTTAGTGGCCTTTCA GGG (reversed) Intronic