ID: 1060515788

View in Genome Browser
Species Human (GRCh38)
Location 9:124264898-124264920
Sequence GAGGAACGTGAGCTCCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060515778_1060515788 15 Left 1060515778 9:124264860-124264882 CCTGGCATCAGAGCTTTCCCTGA No data
Right 1060515788 9:124264898-124264920 GAGGAACGTGAGCTCCGGGGAGG No data
1060515782_1060515788 -3 Left 1060515782 9:124264878-124264900 CCTGAAAGGCCACTAAGGATGAG No data
Right 1060515788 9:124264898-124264920 GAGGAACGTGAGCTCCGGGGAGG No data
1060515781_1060515788 -2 Left 1060515781 9:124264877-124264899 CCCTGAAAGGCCACTAAGGATGA No data
Right 1060515788 9:124264898-124264920 GAGGAACGTGAGCTCCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060515788 Original CRISPR GAGGAACGTGAGCTCCGGGG AGG Intronic