ID: 1060517037

View in Genome Browser
Species Human (GRCh38)
Location 9:124272344-124272366
Sequence CATGAAGTCCCTGCCTGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060517031_1060517037 22 Left 1060517031 9:124272299-124272321 CCACAGATCCAGGCGCTCTGCTG 0: 1
1: 0
2: 0
3: 29
4: 243
Right 1060517037 9:124272344-124272366 CATGAAGTCCCTGCCTGCACAGG No data
1060517030_1060517037 23 Left 1060517030 9:124272298-124272320 CCCACAGATCCAGGCGCTCTGCT 0: 1
1: 0
2: 0
3: 5
4: 141
Right 1060517037 9:124272344-124272366 CATGAAGTCCCTGCCTGCACAGG No data
1060517032_1060517037 14 Left 1060517032 9:124272307-124272329 CCAGGCGCTCTGCTGAGATACAG 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1060517037 9:124272344-124272366 CATGAAGTCCCTGCCTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060517037 Original CRISPR CATGAAGTCCCTGCCTGCAC AGG Intronic
No off target data available for this crispr