ID: 1060517952

View in Genome Browser
Species Human (GRCh38)
Location 9:124277500-124277522
Sequence CCCTTTCCTGCTGGGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060517944_1060517952 -10 Left 1060517944 9:124277487-124277509 CCACCTTCTCCTACCCTTTCCTG 0: 1
1: 1
2: 9
3: 118
4: 1160
Right 1060517952 9:124277500-124277522 CCCTTTCCTGCTGGGTGTTGGGG No data
1060517943_1060517952 -7 Left 1060517943 9:124277484-124277506 CCACCACCTTCTCCTACCCTTTC 0: 1
1: 0
2: 16
3: 206
4: 1957
Right 1060517952 9:124277500-124277522 CCCTTTCCTGCTGGGTGTTGGGG No data
1060517940_1060517952 -1 Left 1060517940 9:124277478-124277500 CCCATCCCACCACCTTCTCCTAC 0: 1
1: 0
2: 6
3: 57
4: 650
Right 1060517952 9:124277500-124277522 CCCTTTCCTGCTGGGTGTTGGGG No data
1060517942_1060517952 -6 Left 1060517942 9:124277483-124277505 CCCACCACCTTCTCCTACCCTTT 0: 1
1: 0
2: 5
3: 56
4: 586
Right 1060517952 9:124277500-124277522 CCCTTTCCTGCTGGGTGTTGGGG No data
1060517939_1060517952 13 Left 1060517939 9:124277464-124277486 CCTCAGCTCTTTCTCCCATCCCA 0: 1
1: 0
2: 12
3: 79
4: 669
Right 1060517952 9:124277500-124277522 CCCTTTCCTGCTGGGTGTTGGGG No data
1060517941_1060517952 -2 Left 1060517941 9:124277479-124277501 CCATCCCACCACCTTCTCCTACC 0: 1
1: 1
2: 9
3: 108
4: 1109
Right 1060517952 9:124277500-124277522 CCCTTTCCTGCTGGGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060517952 Original CRISPR CCCTTTCCTGCTGGGTGTTG GGG Intronic
No off target data available for this crispr