ID: 1060518327

View in Genome Browser
Species Human (GRCh38)
Location 9:124279629-124279651
Sequence GTCCTCCCACTGCACAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 302}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060518327_1060518335 20 Left 1060518327 9:124279629-124279651 CCCCACCTGTGCAGTGGGAGGAC 0: 1
1: 0
2: 2
3: 31
4: 302
Right 1060518335 9:124279672-124279694 TGAGTGCTGATTATGTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060518327 Original CRISPR GTCCTCCCACTGCACAGGTG GGG (reversed) Intronic
900473729 1:2866657-2866679 CTCCTCCCCCTGCCCAGGTGAGG - Intergenic
900527678 1:3137056-3137078 GTCATCCCATTTCACAGGTGAGG + Intronic
900602922 1:3510751-3510773 GCCCTGCCACTGCACAGCTGGGG - Intronic
900937163 1:5773705-5773727 GGCCTCCCATTTCACAGATGTGG + Intergenic
901464687 1:9413632-9413654 GGCCTCACCCTGCTCAGGTGGGG - Intergenic
902805203 1:18857033-18857055 ATCATCCCACTTTACAGGTGAGG + Intronic
902809013 1:18877793-18877815 ATTCTCCCACTCCACAGATGAGG + Intronic
903171851 1:21559176-21559198 GGCCTCCCACTGCACAGAACGGG - Intronic
903178598 1:21594516-21594538 GCACCCCCACTGCACAGATGAGG + Intergenic
904342260 1:29844337-29844359 ATCCTCCCACTGTACAGATGAGG - Intergenic
904399956 1:30249619-30249641 ATCCTCCCACTGTACACATGAGG + Intergenic
904424722 1:30415931-30415953 GTCCTCCCACCCCACAGGGCAGG - Intergenic
905232760 1:36525314-36525336 GTCCCCACACGGCACATGTGCGG + Intergenic
905240074 1:36575731-36575753 GTCCTCCCCCAGCACAGGACTGG + Intergenic
905295394 1:36951434-36951456 TTCTTCCCACTGCACACTTGGGG + Intronic
905349301 1:37333560-37333582 GCACTCCCACTTCACAGGGGAGG - Intergenic
905876245 1:41433610-41433632 CTGCTCCCATTGCACAGTTGAGG - Intergenic
907242056 1:53086351-53086373 CTCCTCCCACTGCAGGGCTGGGG - Intergenic
907708721 1:56856315-56856337 TTCCTCCCATTGTACAGGTAAGG - Intronic
908951548 1:69568134-69568156 ATCCTCGCCCTGCACAGGCGCGG + Intergenic
910473176 1:87577211-87577233 GTCCTCTGACTCCACAGCTGCGG + Intergenic
912735321 1:112145095-112145117 ATCCTCCCCCTGCCCAGCTGGGG - Intergenic
913502252 1:119481983-119482005 ATCTTTCCACTGCACAGATGAGG + Intergenic
915234424 1:154470074-154470096 TTCCTCTGACTGCCCAGGTGGGG - Intronic
915837527 1:159189461-159189483 GTTCTCCCACTTCGCAGATGAGG - Intronic
916105219 1:161424668-161424690 CTCCTCCCTCTGCACTGGTGAGG - Intergenic
916652789 1:166846494-166846516 GTCCTCTCACAGGTCAGGTGAGG - Intronic
918789627 1:188809908-188809930 CTCCTCCCACTCCACAGAAGAGG - Intergenic
919478425 1:198056547-198056569 GTCCTGCTACTGGACAGATGGGG + Intergenic
920081786 1:203380089-203380111 GCCCTCTCCCTGCACAGGGGAGG + Intergenic
920515983 1:206584912-206584934 TTCCTCCCATTGCACAGATCAGG - Intronic
920535465 1:206734001-206734023 GGCCTCCCCCAGCACAGATGAGG + Exonic
921339516 1:214120764-214120786 GGCCTCCCACTGCACACTGGTGG + Intergenic
922822873 1:228495963-228495985 GCCCTCCCTCTGCACATATGTGG + Intergenic
923008599 1:230070992-230071014 TTACTCCCACTGCAAAGATGAGG - Intronic
923459673 1:234197382-234197404 GTCCTTCCAGGGCAAAGGTGAGG + Intronic
923475525 1:234327826-234327848 ATCCTCCCACAGCACAGGAGAGG + Intergenic
924051052 1:240079931-240079953 ATCTTCACACTGAACAGGTGGGG - Intronic
924707669 1:246512344-246512366 GTCATCCCACGGCAGAGGTTGGG - Intergenic
1063347378 10:5324726-5324748 TTCCTCCCACTGCACTGTCGCGG - Intergenic
1064628733 10:17287317-17287339 GTCATCCCTCTGCTCATGTGAGG + Intergenic
1065961061 10:30734723-30734745 GTGCCCCCATTTCACAGGTGAGG - Intergenic
1066686182 10:37983700-37983722 GACTTCCCACAACACAGGTGTGG + Intergenic
1067217049 10:44311682-44311704 GTCTGCCCACTGCACAGGACGGG + Intergenic
1067290094 10:44934040-44934062 TTCCTCCCACTGACCATGTGTGG + Intronic
1068060723 10:52064505-52064527 GTCCCCCAACAGCACAGGGGAGG + Intronic
1072637800 10:97188488-97188510 CTGCTCCCGCTGCACGGGTGGGG + Intronic
1074110304 10:110417899-110417921 GTCCTCCCACTTCATGGCTGTGG + Intergenic
1074974564 10:118569630-118569652 GTCCTCCTCCTCAACAGGTGGGG + Intergenic
1075291794 10:121237084-121237106 GTCCTCCCACTGCTCTGTGGTGG - Intergenic
1076132750 10:128025408-128025430 AGCCTCCCACTGGAGAGGTGAGG + Intronic
1076526631 10:131116374-131116396 GAGCACCCACTGCACAGATGGGG - Intronic
1076689485 10:132214763-132214785 GGCATCCCACTGCACATGAGGGG + Intronic
1077028437 11:452023-452045 GTCCTCCCGCAGCACAGCTGGGG + Intronic
1077589299 11:3479363-3479385 GTCCTCCTACAGCACAAGTCCGG + Intergenic
1079151209 11:17901125-17901147 CTCCTCCCACTCCCCAAGTGTGG + Intronic
1080841421 11:35986771-35986793 GTCCTCCCATTTCCCAGGTTAGG - Intronic
1080897440 11:36458346-36458368 GTATGCCCACTGCACAGATGAGG - Intronic
1081672113 11:44948263-44948285 TTCCTCCCCTTTCACAGGTGAGG - Intronic
1081775953 11:45676041-45676063 TTCAACCCACTGAACAGGTGGGG + Intergenic
1083124025 11:60545118-60545140 CCCCTCTCACTGCAGAGGTGAGG + Intergenic
1083451488 11:62748945-62748967 GCCCTCCTACAGCACAGGCGGGG + Intronic
1083544576 11:63538802-63538824 ATCATCCCATTGCACAGATGGGG - Intronic
1083826305 11:65205855-65205877 CTCTGCCCACTGAACAGGTGGGG - Intronic
1084219093 11:67666742-67666764 GCCCACCCACTGCACACTTGGGG + Intronic
1084271102 11:68029672-68029694 GTCCTCCCTCTGCACGGGCATGG + Intergenic
1084679888 11:70660818-70660840 GGCCTCCTGCAGCACAGGTGCGG + Intronic
1085040375 11:73323295-73323317 GGACTCCCACTTCACAGATGGGG - Intronic
1085048140 11:73365104-73365126 GGCCTCCCCCTGGACAGGTGGGG - Intronic
1085810113 11:79672336-79672358 GTCCTCCCACTGGTCAGGTGTGG - Intergenic
1088789061 11:113208170-113208192 ACCGTCCCACTGCTCAGGTGAGG - Intronic
1089068014 11:115676709-115676731 GTCCTCCCTCTGCACTGGACTGG + Intergenic
1089242457 11:117094080-117094102 GTCATCCCACTTTACAGATGAGG + Intronic
1090237034 11:125156506-125156528 GCCTTCCCTCTGCACAGGTGGGG - Intergenic
1090253159 11:125264867-125264889 GTCCTCCCATTTCACAGATGGGG - Intronic
1090732231 11:129581753-129581775 CACCTCCCATTGCAGAGGTGAGG + Intergenic
1091700098 12:2653535-2653557 CTCCTCCGACTACACATGTGCGG - Intronic
1091883706 12:4000759-4000781 GTCATCACACTGCAAAGATGGGG + Intergenic
1094095006 12:26693929-26693951 TTCATCCCATTACACAGGTGGGG + Intronic
1095978131 12:47953855-47953877 GACCTCCCTTTGCACTGGTGGGG - Intergenic
1096584281 12:52609464-52609486 CTCTTCCCACTGCAGAGATGTGG + Intronic
1096606958 12:52773720-52773742 GTCCTGTCTCTGCGCAGGTGAGG - Intronic
1100476951 12:94943662-94943684 CTCGTCCCACTGCACAGTTCTGG - Intronic
1100599493 12:96100673-96100695 GTTTTCCCACTTCACAGATGGGG + Intergenic
1101818713 12:108166220-108166242 ATCATCCCACTGCACAAATGAGG - Intronic
1101889587 12:108701119-108701141 GTCCTCCCTCTGCACAAGGTAGG - Exonic
1102626361 12:114238608-114238630 GTCCTGCCACTTCCCAGCTGTGG - Intergenic
1102802891 12:115751947-115751969 GTTCTCCCACTTTATAGGTGAGG - Intergenic
1103197283 12:119055789-119055811 TTGCTCCCATTTCACAGGTGAGG - Intronic
1103392368 12:120583946-120583968 GTTATCCCATTGCACAGATGAGG - Intergenic
1103611943 12:122129425-122129447 TTCCACCCAGTGCACAGATGGGG - Intronic
1104694284 12:130851875-130851897 GTTCTCCCACTTCACAGCAGTGG - Intergenic
1104954686 12:132458454-132458476 ATCCTCCCCCTTTACAGGTGAGG + Intergenic
1104998245 12:132672573-132672595 GTCCTACCACAGCACAAGAGTGG + Intronic
1105439630 13:20404549-20404571 GCCCACCCGCTGCAGAGGTGAGG + Intronic
1106199649 13:27525752-27525774 ATCCTCACCCTGCACAGATGGGG + Intergenic
1107419551 13:40233813-40233835 GGCCTCACACTGGACATGTGAGG - Intergenic
1109657600 13:65414209-65414231 ATCCTTCCATTTCACAGGTGTGG - Intergenic
1111927500 13:94478955-94478977 GACCTGCAAGTGCACAGGTGAGG - Exonic
1113450757 13:110407771-110407793 GTCCTCACACTGCACTGGGAGGG - Intronic
1113488064 13:110669766-110669788 CCCCTCACACTTCACAGGTGAGG - Intronic
1113775034 13:112939311-112939333 GACCTCACACTGCACAGGTTGGG - Intronic
1113878858 13:113611410-113611432 TTCCTCAAACAGCACAGGTGAGG - Intronic
1113924095 13:113930726-113930748 ATACTCCCACTTTACAGGTGGGG - Intergenic
1117805116 14:59483524-59483546 CGCCTCCCTCTGCACTGGTGAGG - Intronic
1118362228 14:65066211-65066233 GGCATCACACTGCACTGGTGTGG - Intronic
1119656462 14:76420860-76420882 GTCATCCATGTGCACAGGTGGGG - Intronic
1119939369 14:78624494-78624516 GTATGCCCACTGCACAGGGGCGG + Intronic
1120852950 14:89187368-89187390 GTCCTGCCACTGCCCATGAGTGG - Intronic
1121620054 14:95340280-95340302 TTCCACCCCCTGCACAGGAGGGG - Intergenic
1122203131 14:100134564-100134586 TCCCTCCCACTGCACTTGTGTGG - Intronic
1122355571 14:101121154-101121176 GTCCTCCCAGGGCTCAGGGGAGG + Intergenic
1122411663 14:101528868-101528890 CTCAGCCCACTGCACAGATGGGG + Intergenic
1122743591 14:103885569-103885591 GTCCTCCCACAGCCGAGGTCAGG + Intergenic
1123680664 15:22760879-22760901 GACCTCCCATTGGCCAGGTGTGG - Intergenic
1123986724 15:25652864-25652886 GTGCTCCTGCTGCACAGATGAGG - Intergenic
1124332875 15:28835337-28835359 GACCTCCCATTGGCCAGGTGTGG - Intergenic
1124379175 15:29150133-29150155 TTCATTCCACTTCACAGGTGAGG + Intronic
1126038523 15:44569500-44569522 GTCCTCCCACTTCACAGGTACGG - Exonic
1126860784 15:52880617-52880639 TCCTTCCCACTTCACAGGTGAGG + Intergenic
1127677676 15:61258250-61258272 CTCCAGCCAGTGCACAGGTGTGG + Intergenic
1128311865 15:66636004-66636026 GTGCTGCCACTGCCCAGCTGTGG + Intronic
1128450937 15:67805540-67805562 GTCCTCCACCTGCACAGGCTGGG - Intronic
1128721985 15:69956842-69956864 GTATTCCCATTTCACAGGTGAGG + Intergenic
1128978187 15:72168201-72168223 GGCCTCTCACTGAGCAGGTGGGG - Intronic
1129701932 15:77773184-77773206 GGCCTCCCATTGCTCAGATGTGG - Intronic
1131020070 15:89089970-89089992 GTCTCCTCAATGCACAGGTGAGG + Intronic
1131119367 15:89813461-89813483 CTGCTCCCGCTTCACAGGTGGGG - Intronic
1131157657 15:90084933-90084955 GTCCTGCCCTTGCACAGATGGGG - Intronic
1132360411 15:101208205-101208227 GTCAGCCCACTGCTCAGGAGTGG + Intronic
1132508069 16:322438-322460 GTGTTTCCTCTGCACAGGTGTGG + Intronic
1132543943 16:524515-524537 ACCATCCCACTGCACAGCTGGGG - Intergenic
1133595611 16:7288418-7288440 CTCCTCCCATTTCACAGGTAAGG - Intronic
1134036754 16:11037049-11037071 TTATTCCCACTTCACAGGTGAGG + Intronic
1135594497 16:23731254-23731276 TTTCTCCCAGTTCACAGGTGGGG + Intergenic
1137408443 16:48208156-48208178 ATCCTCACAGAGCACAGGTGAGG + Intronic
1137583667 16:49650885-49650907 GTCCTCCCACTGGACAGTCTGGG + Intronic
1138086141 16:54135351-54135373 GTCCTTCCACTTCACAAGGGAGG + Intergenic
1138344694 16:56312698-56312720 GGCCTCCACCTGCAGAGGTGCGG - Intronic
1139597435 16:67966631-67966653 GGCCTCCCAGAGCAGAGGTGTGG + Intronic
1141660865 16:85440829-85440851 GGCCTCCCAGGGCACAGATGTGG - Intergenic
1141768035 16:86071539-86071561 CTCCTCCCATTTCACAGATGAGG - Intergenic
1141882551 16:86869479-86869501 AGCCTCCCACTGCACCTGTGGGG + Intergenic
1142004537 16:87683175-87683197 TTCCTGCCACTGCCCCGGTGTGG - Intronic
1142351630 16:89583360-89583382 GGCCTGCACCTGCACAGGTGTGG - Intronic
1144418740 17:15075898-15075920 GTCTTCCCACGGTACAGGTCTGG - Intergenic
1145006611 17:19342126-19342148 TTCCTCCCACTCCCCATGTGCGG - Intronic
1146125179 17:30225715-30225737 GTCATTCCACAGCAGAGGTGGGG - Intronic
1147169474 17:38609548-38609570 CTCCTCCCACTCCATAGGAGAGG + Intergenic
1148198701 17:45733454-45733476 ATCCTCCCACTGTTCAGGAGGGG + Intergenic
1148355802 17:46974836-46974858 CTCCTCCCATTGTACAGATGAGG - Intronic
1148695173 17:49554545-49554567 GTTATCCCACTTCACAGGTGAGG + Intergenic
1149524510 17:57344350-57344372 GGCCTCCCACTGGCCAAGTGTGG - Intronic
1150217947 17:63480685-63480707 GTGTTCCCACTTTACAGGTGGGG + Intergenic
1150595730 17:66602805-66602827 CTCCTCCCAGTGCACAGGCCAGG - Intronic
1151697419 17:75724612-75724634 TTCCTCTCGCTGCACAGCTGTGG - Intronic
1152162148 17:78675482-78675504 GAGCTCCCACAGCACAGGAGAGG + Exonic
1153902544 18:9630775-9630797 CTCCCCACACTGCCCAGGTGCGG - Intergenic
1154009931 18:10565616-10565638 GCCCTCCCACTGGAAAGGTCAGG + Intergenic
1155201150 18:23518932-23518954 GACCTCCAACAGCACAGGAGCGG + Exonic
1155555711 18:27016899-27016921 ATCCTCTCACTGCAAAGGTGAGG + Intronic
1156228786 18:35134167-35134189 GTCATCCCATTGTACAGATGAGG + Intronic
1161329532 19:3679643-3679665 GTGCTCCCCCTCCACAGCTGAGG - Intronic
1161354967 19:3813836-3813858 GTCCTCCCGCATCAGAGGTGAGG + Exonic
1161482470 19:4517849-4517871 GTCTGCCCATTGCCCAGGTGTGG - Intergenic
1161517036 19:4702335-4702357 TGCTTCCCACTGCACAGGGGAGG - Intronic
1162361220 19:10221622-10221644 ATCCTCCCACTGGAGAGCTGGGG - Intronic
1163299373 19:16434121-16434143 ATCCTTCCACTTCACAGATGAGG - Intronic
1163642661 19:18470342-18470364 GCCCCCCCACTGCTCAGGTTGGG + Intronic
1164848726 19:31461198-31461220 TTTCTCCCACTGGTCAGGTGTGG + Intergenic
1165863910 19:38924369-38924391 ATCATCCCACTTCACAGATGGGG - Intronic
1166522052 19:43487018-43487040 GTCCTTCCATTGTACTGGTGAGG - Exonic
1167494168 19:49808375-49808397 GTGCTCCCACTGCGCAGGCGGGG - Intronic
1167813644 19:51858049-51858071 ATGCTCCCACTGCACAGGAAAGG + Intronic
1168584908 19:57584240-57584262 GTCCTCCCGCTGAACAGTGGGGG + Exonic
925532410 2:4878682-4878704 GACCTCACCATGCACAGGTGTGG - Intergenic
926311496 2:11679044-11679066 ATCTTCCCAGTGGACAGGTGGGG + Intronic
927475870 2:23413839-23413861 GGCCTCCCACCGCACCCGTGGGG - Intronic
927845840 2:26472584-26472606 CTCCTCTCACTCCACAGGGGAGG - Exonic
927911682 2:26904171-26904193 GCCCTCCCACTGCAGAGTTCTGG + Intronic
928294146 2:30068272-30068294 GTCTTCCAATTGCACAGCTGGGG - Intergenic
929877938 2:45812549-45812571 TTACTCCCACTGCACAGAGGAGG - Intronic
930027132 2:47035863-47035885 GATCTCCCACTGCAGAGGAGAGG - Intronic
933809980 2:86027124-86027146 GGCCTCCTGCAGCACAGGTGAGG + Exonic
935131164 2:100261992-100262014 GTTATCCCATTTCACAGGTGAGG + Intergenic
936996756 2:118423932-118423954 GTCCTCCCAGGGCAGGGGTGCGG + Intergenic
937228065 2:120381160-120381182 ATCATCCCATTTCACAGGTGTGG + Intergenic
937264139 2:120605532-120605554 GTTCTACCCCTGCACAGTTGCGG + Intergenic
937465904 2:122132832-122132854 CTTCTCCCATTGCACAGATGAGG - Intergenic
938953944 2:136281740-136281762 GCCCTCCCAGTTCACAGGAGAGG - Intergenic
940140776 2:150488391-150488413 GTCCCCTCACTGCAAATGTGGGG - Intronic
944851084 2:203719914-203719936 GTCAACCCTCTGCATAGGTGGGG - Intronic
946051310 2:216864691-216864713 GCTCTTCCACTGCCCAGGTGTGG - Intergenic
947819698 2:233061260-233061282 CTCCTCCCACTGCCCGGTTGGGG + Intronic
1168750452 20:278042-278064 GTCCTCCCATTTTACAGATGAGG - Intronic
1168841535 20:912978-913000 GTTCCCCCAGTGTACAGGTGAGG - Intronic
1168961388 20:1872377-1872399 GTCCTCCCATTTTACAGATGAGG - Intergenic
1169325373 20:4671277-4671299 ATGCTCCGAGTGCACAGGTGGGG - Intergenic
1170746775 20:19106602-19106624 TTGATCCCATTGCACAGGTGAGG + Intergenic
1171278570 20:23878637-23878659 GCCCTCTCCCTGCACAGGAGGGG - Intronic
1171283651 20:23921141-23921163 GCCCTCTCCCTGCACAGGAGGGG - Intergenic
1171334815 20:24374048-24374070 GTCCTCTCCCTCCAGAGGTGAGG + Intergenic
1172146428 20:32761713-32761735 GTCATCCCAGGGCAGAGGTGGGG + Intergenic
1172613376 20:36267542-36267564 GTCCTGCCACTGGGTAGGTGTGG + Intronic
1172623160 20:36332696-36332718 GTGCCCCCATTTCACAGGTGAGG + Intronic
1172657473 20:36545976-36545998 GGCTGCCCACTGCACAGATGGGG + Intronic
1172828099 20:37807383-37807405 GCCCTCCCACAGTAGAGGTGTGG - Intronic
1173645259 20:44629307-44629329 CTGCTCCCACTGGACAGATGGGG + Intronic
1173945148 20:46944390-46944412 TTATTCCCACTGCCCAGGTGAGG - Intronic
1174158942 20:48536656-48536678 GTTCTCCCACTTTACAGATGAGG - Intergenic
1174301462 20:49585485-49585507 GGCCTGCCACTGCATAGATGTGG - Intergenic
1174685721 20:52453068-52453090 GTCCCCCCACTCCACACATGGGG - Intergenic
1176187809 20:63790923-63790945 GGCCTCCCGCTGCACACCTGTGG - Exonic
1177840168 21:26227228-26227250 GTCCTCCCACTGCTTCAGTGTGG + Intergenic
1178486279 21:33021674-33021696 ATCGTCTCACTGCAAAGGTGGGG + Intergenic
1178734455 21:35136500-35136522 GTCCTCCCACAGCCCAAGTGGGG - Intronic
1179162063 21:38906914-38906936 ATGCCCTCACTGCACAGGTGGGG + Intergenic
1179516991 21:41915233-41915255 ACCCTAGCACTGCACAGGTGAGG + Intronic
1180098672 21:45574247-45574269 GTCCTGCCAGGGCGCAGGTGTGG - Intergenic
1180593313 22:16958249-16958271 CTCCACCCACTGCACAAGTGGGG - Intergenic
1181322516 22:22019344-22019366 CTCCTCACTCTGCACAGGTGAGG + Intergenic
1181518979 22:23434543-23434565 GTCTCCCCATTTCACAGGTGGGG + Intergenic
1182010332 22:26995334-26995356 ATCATCCCTCTACACAGGTGAGG - Intergenic
1182187217 22:28417802-28417824 GTCCTCCCAATACATAGATGAGG + Intronic
1182359856 22:29740068-29740090 AGCCTCTCACTGAACAGGTGGGG - Intronic
1183326521 22:37197549-37197571 TTCAACCCACTTCACAGGTGAGG + Intronic
1184102159 22:42346568-42346590 GTGCCCCCACTTCACAGCTGAGG - Intergenic
1184711730 22:46254528-46254550 ATTCTCCCACTGCACAGCTCAGG + Intergenic
1184849356 22:47111108-47111130 CTCCTCCCACTCCACAGATGAGG - Intronic
1185041796 22:48507951-48507973 TTCTCCCCACTGCACAGATGAGG - Intronic
949859102 3:8489380-8489402 GTACTCCCATTTCACAGATGAGG - Intergenic
950644774 3:14370656-14370678 ATCCTTACACTGTACAGGTGGGG - Intergenic
953410310 3:42687165-42687187 GTCCTCCCATTGTACAGATGAGG + Intronic
953666415 3:44929256-44929278 GTCCTCCCCATCCCCAGGTGTGG + Intronic
953735601 3:45491683-45491705 GTCCTCCAGGGGCACAGGTGTGG - Exonic
954329108 3:49879904-49879926 GTCCACCTCCTGCAGAGGTGGGG + Intergenic
954428787 3:50458200-50458222 GGCTTCCCACTGCGCAGATGGGG + Intronic
954622104 3:52002241-52002263 ATCACCCCACTTCACAGGTGGGG + Intergenic
960971337 3:123142144-123142166 TTCCTCTCACTGCTGAGGTGGGG + Intronic
965661260 3:171044547-171044569 GTCCTCCCTCTGCAAGGGTTGGG + Intergenic
966255960 3:177917360-177917382 GTCCTCCCACTCCACAGAGCAGG + Intergenic
966769619 3:183492223-183492245 TTCCTCCCTCTCCTCAGGTGGGG - Exonic
967004207 3:185368209-185368231 GTATTCCCACTGTACAGATGAGG + Intronic
967316367 3:188154613-188154635 GTCCTCCCATTTTACAGTTGGGG + Intronic
967863299 3:194169822-194169844 TCCCTCACACTGCAGAGGTGGGG + Intergenic
968052695 3:195666373-195666395 GTCCTCACCCTTTACAGGTGAGG - Intergenic
968103115 3:195981981-195982003 GTCCTCACCCTTTACAGGTGAGG + Intergenic
968301428 3:197619559-197619581 GTCCTCACTCTTTACAGGTGAGG + Intergenic
968918412 4:3508884-3508906 GGCTTCTCACTGCACTGGTGAGG - Exonic
969502166 4:7559726-7559748 GTCATCCCATTTCACAGGTGAGG - Intronic
970171358 4:13294020-13294042 TTCTTCCCACTTCACAGATGAGG - Intergenic
975556720 4:75672938-75672960 GGGCTCCGAGTGCACAGGTGGGG - Intronic
980091909 4:128451638-128451660 GTCCTCTCATTTCACAGATGGGG + Intergenic
985498944 5:228492-228514 GTCCTCACCCTTTACAGGTGAGG - Intronic
985763737 5:1765473-1765495 CACGGCCCACTGCACAGGTGGGG + Intergenic
986161589 5:5234395-5234417 GTCCTCACCCTGCACAGGGAGGG - Intronic
986391657 5:7292850-7292872 GACCTCCCATTGGCCAGGTGTGG - Intergenic
991176600 5:63695474-63695496 GTCCTGCCACTTCTCAGATGTGG - Intergenic
992130048 5:73682883-73682905 TCCCTCCCACTGCACATTTGAGG - Intronic
992417664 5:76567197-76567219 GTATTCCCACTTCACAGGTGAGG - Intronic
995271731 5:110227756-110227778 GTCCTTCCACTGGAGAGGTTGGG - Intergenic
998008867 5:138676952-138676974 GGCCTCCCACTGCCCAGGAGGGG - Intronic
998151199 5:139758548-139758570 GTGCCCACACTGCACAGGGGAGG - Intergenic
1000994208 5:167942565-167942587 TTCCTCCCACTGCAAAACTGAGG + Intronic
1001532640 5:172474965-172474987 TTCCTCCCATTTCACAGATGGGG + Intergenic
1002212268 5:177606016-177606038 GTCCTCCCTCTGCACTGGCTGGG + Intronic
1006205645 6:32339716-32339738 CTCCTCCCCCTCCTCAGGTGTGG + Intronic
1006514525 6:34538563-34538585 GGCCTCCCCCTGCTCGGGTGGGG + Intronic
1006862698 6:37183512-37183534 TTCCTCCCACAGCACTGCTGAGG - Intergenic
1007177981 6:39909444-39909466 GACCTCGCAGTGCACATGTGGGG - Intronic
1007692895 6:43714362-43714384 GTTCTCCCATTGCACAAATGAGG + Intergenic
1015188309 6:130444394-130444416 CTCATCTCACTTCACAGGTGAGG - Intergenic
1016468888 6:144354071-144354093 GTGCCTGCACTGCACAGGTGAGG - Intronic
1017295471 6:152788647-152788669 GTCCTTCTATTGTACAGGTGTGG + Intergenic
1017983846 6:159425383-159425405 GTCCTTCCCCTGCACATGAGAGG + Intergenic
1018151696 6:160945744-160945766 CTCCTCCCACTGCCCAGGCAGGG + Intergenic
1018721287 6:166574450-166574472 GACCTCCAGCTGCACAGATGTGG + Intronic
1019428183 7:987093-987115 GTCATCCCCCTGCAGAGGCGTGG - Exonic
1019444436 7:1063969-1063991 TTCTTCCCTCTGCAGAGGTGGGG + Intronic
1019451961 7:1103703-1103725 GTCCCCACCCTGCACAGGAGAGG + Intronic
1019511343 7:1419120-1419142 GTTCTCCCATTTCACAGATGGGG + Intergenic
1019592307 7:1841783-1841805 GTCTCCCCATTTCACAGGTGGGG - Intronic
1019655914 7:2195562-2195584 GTCCTCCCACAGCAAGGGAGGGG - Intronic
1022831242 7:34068836-34068858 GACCTCTCACTTCACAGGTGAGG + Intronic
1023088094 7:36592437-36592459 GTCCTCCCCATGTAGAGGTGTGG - Intronic
1023306005 7:38827594-38827616 GGCCTCCCACTGCCAAGATGGGG + Intronic
1025569444 7:62540577-62540599 GCCCTCCAAATGCCCAGGTGCGG - Intergenic
1025610566 7:63072727-63072749 TTCCTCACACAGCACAGATGAGG - Intergenic
1026928126 7:74207781-74207803 ATCACCCCACTGCACAGATGAGG + Intronic
1032196830 7:129794292-129794314 TTCCACCCACTTCACAGGTGGGG + Intergenic
1034273664 7:149814928-149814950 TTCCACCCAGTGCACAGGTCAGG + Intergenic
1035289158 7:157826663-157826685 CTCTTCCCAGTTCACAGGTGAGG + Intronic
1036313109 8:7699207-7699229 GGCCTCCCCCTCCACAGCTGTGG + Intergenic
1036433596 8:8712408-8712430 GTCCCCCAGCTGCACAGGAGTGG - Intergenic
1036751615 8:11447050-11447072 AGGCTCCCACTGCAGAGGTGAGG + Intronic
1037926723 8:22849390-22849412 GGCGTCCCACTGCACAGGCAGGG + Intronic
1037935475 8:22912540-22912562 GTTCTCCCACTTCCCAGGTTTGG + Intronic
1037938092 8:22928501-22928523 TTCCTCCCAGTGCACTGCTGGGG - Intronic
1039618367 8:38974694-38974716 GTTCCCCCACTGCACAGGCACGG - Exonic
1040790940 8:51229797-51229819 GTCCACCCAGTGCCCAGATGAGG + Intergenic
1042227517 8:66525535-66525557 CCCCTCCCACTGCACAGGCCGGG - Intergenic
1045252793 8:100495586-100495608 ATCCTCCCATTTCCCAGGTGAGG - Intergenic
1047893071 8:129334319-129334341 ATCCCCCCACTGCACATTTGAGG - Intergenic
1049197696 8:141324657-141324679 GTGTTCCCACTATACAGGTGAGG - Intergenic
1049520100 8:143083423-143083445 GTGGTCCCAATGCACAGGTGGGG - Intergenic
1049879151 8:145050648-145050670 GTCCTCTGAGTGCACATGTGCGG - Intergenic
1050337291 9:4601797-4601819 GTCCTCCCAACCCACAGGAGTGG + Intronic
1050452703 9:5800382-5800404 GTCCTCAAACTGGCCAGGTGTGG + Intronic
1051001693 9:12290486-12290508 GTCCTCCCAATCCACAGATCAGG + Intergenic
1054927199 9:70601160-70601182 GACGTCCCACTGCACAGGTCTGG - Intronic
1056720965 9:89071499-89071521 GTCATCCCACTTTACAGGTGAGG + Intronic
1056850850 9:90082437-90082459 GTTCTCCCTCTGGACAGGTCAGG + Intergenic
1057195151 9:93112401-93112423 ACCATCCCACTGCACAAGTGTGG - Intronic
1059326116 9:113504956-113504978 GCCCTCCCAGAGCACAGGGGAGG - Intronic
1059431914 9:114255448-114255470 CTCCTCCCACTAGACAGATGGGG - Intronic
1059468853 9:114488358-114488380 TTCTTCCCACTGCACAGATGAGG + Intronic
1060260355 9:122069245-122069267 AGTCTCCCACTGCACAGGTAGGG - Intronic
1060403399 9:123361148-123361170 TTCCTTGCACTGCACAGGTGAGG + Intronic
1060518327 9:124279629-124279651 GTCCTCCCACTGCACAGGTGGGG - Intronic
1060667429 9:125440259-125440281 GTCATCCCCATGCACAGGTGAGG + Intronic
1061181504 9:129027649-129027671 AGCCGCCCATTGCACAGGTGCGG + Intronic
1061186913 9:129060217-129060239 GTCCTCCCCCTGCAGAGCTTGGG + Intronic
1061264730 9:129498245-129498267 GTCCACCCACTGCACATGCCAGG - Intergenic
1061274586 9:129562110-129562132 GCCTTCCCACTGCCCAGCTGGGG - Intergenic
1061928637 9:133820731-133820753 TTCCTCCCAGTGGACAGCTGTGG - Intronic
1203698455 Un_GL000214v1:117166-117188 GGCTTCCCGCTGCACAGCTGTGG + Intergenic
1185889355 X:3810637-3810659 GACCTACCACTGCAGAGGTGTGG - Intergenic
1186076721 X:5887597-5887619 GTCTTCTCACTTCAAAGGTGTGG + Intronic
1186842552 X:13498610-13498632 GTCTTCCCATTTCACAGGTCAGG + Intergenic
1187759947 X:22571676-22571698 TACCTCCCACTCCATAGGTGTGG + Intergenic
1192849035 X:74934305-74934327 ATCCTCCCACTTTACAGTTGGGG - Intergenic
1198508101 X:137321333-137321355 GTCCTCACACTCGACAGATGAGG - Intergenic
1199679405 X:150214964-150214986 GCCCTGCCACAGCACAGATGTGG - Intergenic
1199695822 X:150342085-150342107 GCCCTGCCACAGCACAGATGTGG + Intergenic
1199946079 X:152669296-152669318 TTCCCCCCATTGCACAGATGGGG + Intergenic
1200246721 X:154530447-154530469 TTCCACCCGCAGCACAGGTGAGG - Intergenic