ID: 1060522149

View in Genome Browser
Species Human (GRCh38)
Location 9:124300057-124300079
Sequence CTGAGGACACAGAGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 963
Summary {0: 1, 1: 0, 2: 2, 3: 95, 4: 865}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060522131_1060522149 28 Left 1060522131 9:124300006-124300028 CCCCAGAACAGTCTGTGGAAGGT 0: 1
1: 0
2: 0
3: 20
4: 192
Right 1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG 0: 1
1: 0
2: 2
3: 95
4: 865
1060522132_1060522149 27 Left 1060522132 9:124300007-124300029 CCCAGAACAGTCTGTGGAAGGTG 0: 1
1: 0
2: 2
3: 15
4: 230
Right 1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG 0: 1
1: 0
2: 2
3: 95
4: 865
1060522133_1060522149 26 Left 1060522133 9:124300008-124300030 CCAGAACAGTCTGTGGAAGGTGT 0: 1
1: 0
2: 0
3: 13
4: 114
Right 1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG 0: 1
1: 0
2: 2
3: 95
4: 865

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060522149 Original CRISPR CTGAGGACACAGAGGGAGAA GGG Intronic
900106379 1:982975-982997 CCGAGGACACAGATGCAGAAAGG - Intergenic
900230905 1:1556921-1556943 CTGAGATGACAGAGGTAGAACGG - Intronic
900356494 1:2267555-2267577 CTGAGGGCACTGAGGGAGTGGGG + Intronic
900438374 1:2641901-2641923 CAGAGGACACAGAGAGAGGCAGG + Intronic
900496614 1:2978703-2978725 CTGAGGACACCTAGGGGCAAGGG + Intergenic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901456596 1:9366552-9366574 CTGAGGACACACAGGCACAGAGG - Intronic
901467478 1:9431831-9431853 GTGAGGACACAGAGAGAAAGTGG - Intergenic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902548644 1:17206237-17206259 CTGAGTCCCAAGAGGGAGAAAGG - Intronic
902610110 1:17592279-17592301 CTGAGGTCACAGGGGGATAAAGG - Intronic
903352720 1:22727610-22727632 CTGAGGACACACAGAGATAGTGG + Intronic
903451293 1:23455470-23455492 CAGAGGACAAAGAGGGAGTGAGG + Intronic
903678293 1:25080335-25080357 CTGCGGACTCACAGGGAGAGAGG + Intergenic
904585723 1:31579573-31579595 CTGCAGAGTCAGAGGGAGAAGGG + Intronic
904621322 1:31777036-31777058 CTGAGGTCACAGAGGTATATAGG + Intergenic
905245927 1:36613264-36613286 CTGTGGCCACAGAGGCAGAAAGG - Intergenic
905304118 1:37005851-37005873 CTGGGGACACAGAGGTAGATGGG + Intronic
905335586 1:37242452-37242474 CTGGCGACAGAGAGAGAGAATGG - Intergenic
905354679 1:37373120-37373142 CTGGGGAGGCAAAGGGAGAAAGG + Intergenic
905416944 1:37810145-37810167 CTGAGAACACAGCAGGAAAAGGG + Exonic
905695415 1:39969961-39969983 CTGAGGACACAGACAGAAACAGG - Exonic
905788751 1:40778922-40778944 GAGGAGACACAGAGGGAGAAAGG - Intergenic
905859843 1:41342846-41342868 CTGGGGTCACAGAGAGGGAATGG - Intergenic
906662137 1:47590573-47590595 CTGAGGATAGAGAGGGAGGCTGG + Intergenic
906700110 1:47851464-47851486 GTGAGGAAAAAGAGGGAGGAAGG + Intronic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
907410001 1:54277107-54277129 ATGAAGTCACAGAAGGAGAAAGG - Intronic
907434350 1:54434725-54434747 ATGATGACCCAGAGGGGGAAGGG + Intergenic
907652367 1:56307565-56307587 CTGAGGAGAGGGAGAGAGAAGGG - Intergenic
907861139 1:58354647-58354669 AGGAGGACACAGAGGAGGAAGGG + Intronic
908540163 1:65114572-65114594 CTGAGAACACAGAGGTCCAATGG + Intergenic
908656609 1:66395056-66395078 CAGAGAACCCAGAGGGATAAGGG + Intergenic
909051511 1:70773838-70773860 CTGCGGAGACAGTGGTAGAAAGG + Intergenic
909498736 1:76309827-76309849 ATGAGCACAGAGAGGGTGAAGGG - Intronic
909774105 1:79462875-79462897 CTGAGTAGACACAGAGAGAATGG - Intergenic
910368692 1:86493302-86493324 CTGGGGAGACAGGGGCAGAAGGG + Intronic
910668994 1:89754132-89754154 TAGAGGACAGAGAAGGAGAATGG - Intronic
911096997 1:94062756-94062778 GAGAAGACACAGAGGGACAAAGG + Intronic
911355157 1:96808379-96808401 ATGAGGACACAGGGGGAAGATGG - Intronic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
911632390 1:100197886-100197908 AAGATGACACAAAGGGAGAAAGG + Intronic
912503473 1:110137921-110137943 CTGAGGACAGAGCCGAAGAAAGG + Intergenic
912567329 1:110597469-110597491 ATGGGGAGACAGAGGGAGAGGGG + Intronic
912703454 1:111895207-111895229 GTGAGGACGGAGAGGGAGGAGGG + Intronic
913241783 1:116836034-116836056 CTGAGGACAGAGTGGCTGAAAGG - Intergenic
913996599 1:143655909-143655931 CTGAAGACACAGTGGGAAGACGG - Intergenic
914457609 1:147850742-147850764 GTGAAGACACAGAGAGAGACAGG + Intergenic
914833193 1:151185951-151185973 CTAAGGACACAGGGAGATAAGGG + Intronic
914921088 1:151847914-151847936 AAGAGGACACAGAGAGTGAAGGG - Intronic
915376451 1:155400521-155400543 CTGAGGACACTGAGGATCAAGGG + Intronic
915470556 1:156123436-156123458 CTGAGGACACTGGGAGAGAGTGG - Intronic
915537770 1:156547843-156547865 GTGAGGAAACTGAGGGAGAGAGG + Intronic
915577715 1:156791642-156791664 CTGAGGGCACAGTTGGAGAGGGG - Intronic
915656514 1:157365359-157365381 GAGAGGACAGAGAAGGAGAAAGG + Intergenic
915672772 1:157504212-157504234 GAGAGGACAGAGAAGGAGAAAGG - Intergenic
915728281 1:158034163-158034185 CTCAGGAGGCTGAGGGAGAATGG + Intronic
915815749 1:158963009-158963031 CTGAGGATTCATAGGGAGGAGGG - Intronic
915880385 1:159664899-159664921 CTGAGGACAGTCAGGGACAAAGG - Intergenic
916390615 1:164326746-164326768 ATGAGGAGAAAGAGAGAGAAGGG - Intergenic
916763197 1:167835280-167835302 CAGAGGACACAGAAGGGTAAAGG - Intronic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
917218380 1:172701705-172701727 GTGGGAACACAGAGGGAAAATGG + Intergenic
917337300 1:173938772-173938794 CAGAGGACCCTGAGGGAGGAGGG - Exonic
918184917 1:182118585-182118607 AGGAGGAGACAGAGAGAGAAAGG + Intergenic
918661120 1:187090271-187090293 CTGAAGCCATAGAGGGAGAGAGG + Intergenic
919287706 1:195585483-195585505 CTCAGAACAGAGAGAGAGAAAGG + Intergenic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
919819140 1:201462013-201462035 GTGGGGAGACCGAGGGAGAAGGG - Intergenic
919939805 1:202278436-202278458 CTGAGGACAAGGAGGGACAAGGG + Intronic
921828408 1:219700088-219700110 GTGAGGACAGACAGGGAGTAAGG + Intronic
922055781 1:222041248-222041270 CTGAAGTCACAGAGGTAGAGGGG - Intergenic
922715429 1:227868296-227868318 CTGAGATCACAGAGTGAGAGAGG - Intergenic
923006221 1:230052186-230052208 GTGAGGACACAGAGAGAAGATGG + Intergenic
923035049 1:230279809-230279831 CTGAGGACAGGGCGGGAGGAGGG + Exonic
923434873 1:233958353-233958375 CTAAGGAAAAAGAGTGAGAAAGG - Intronic
924093616 1:240527571-240527593 CTGAGGAAGGAGAGGGACAAGGG + Intronic
924866519 1:247987802-247987824 ATGTGGACAAAGTGGGAGAAGGG - Intronic
924894190 1:248317856-248317878 ATGAGGGCACAGTGGGAGTACGG + Intergenic
1062767883 10:79617-79639 ATGAGGACAAAGAGGAAGAAGGG + Intergenic
1062995620 10:1863583-1863605 CTGAAGAGACAGAGGAAGACGGG - Intergenic
1063010962 10:2020995-2021017 GTGAGGACACAGAGGGGAAGAGG + Intergenic
1063255577 10:4323689-4323711 TTGAAGATACTGAGGGAGAAGGG + Intergenic
1064878246 10:20019660-20019682 GTGAGGACACAGTGGGAAAGTGG + Intronic
1065115590 10:22479809-22479831 CTTAGGCCACATAGAGAGAATGG + Intergenic
1065514069 10:26507065-26507087 CTGAGGACAGAGAGGCAGCTGGG + Intronic
1066538902 10:36422637-36422659 GTGAGAAGAAAGAGGGAGAAAGG - Intergenic
1066642575 10:37571077-37571099 CTGGGGACCCAGAGGGAGACAGG - Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067279344 10:44859547-44859569 CTGAGGCCACGCAGAGAGAAGGG + Intergenic
1067314128 10:45145280-45145302 AGAAGGAGACAGAGGGAGAAGGG + Intergenic
1067344820 10:45429367-45429389 CAGAGGACACCGTGGGAGACTGG + Intronic
1068778148 10:60890044-60890066 CTGAGGAAACTGAGGCAGAAAGG + Intronic
1069574490 10:69517037-69517059 CAGAGGTCAGAGAGGGACAAAGG - Intergenic
1069574713 10:69518290-69518312 CTGAGAACACACAAGGACAAGGG + Intergenic
1069859435 10:71461293-71461315 CAGGGGACTCCGAGGGAGAAAGG - Intronic
1069879547 10:71583268-71583290 CTGAGGCCGCAGAGGGAGGCAGG + Intronic
1069959701 10:72072550-72072572 TAGAGGACAGAGAGGGACAAGGG + Intronic
1070128701 10:73641757-73641779 CTGAAGACTGAGAGGGAGACAGG + Exonic
1070322732 10:75366531-75366553 GTGGGGACACAGAGGCAGAGCGG - Intergenic
1070574212 10:77665279-77665301 CAGAGGAAACAGGGTGAGAAAGG + Intergenic
1070653834 10:78257102-78257124 CTGAGGAGACAAGTGGAGAAAGG + Intergenic
1071341687 10:84654680-84654702 CTGGGGACATAGAGGGTAAAAGG - Intergenic
1071371094 10:84952488-84952510 CTCAGGATAGAGAGGGGGAATGG + Intergenic
1072152875 10:92697127-92697149 CTGAGGAGACATGGGGAGTAGGG - Intergenic
1072231040 10:93414211-93414233 GGGAGGACACAGAAGGAGAAAGG - Intronic
1072349993 10:94547317-94547339 ATGAAGAAACTGAGGGAGAAGGG + Intronic
1073205332 10:101766380-101766402 GTGAGGTCACAGAGACAGAAGGG - Intergenic
1073423615 10:103443052-103443074 CTGAGGACACAGATAGAGGCTGG + Intronic
1074210699 10:111331537-111331559 CTGAGGAGATGGAGGGAGACAGG - Intergenic
1074572003 10:114632737-114632759 CCGATGAAACAGAGGGAGAAGGG - Intronic
1074600593 10:114909437-114909459 CTGAGGAAACAGTGAGAGAGAGG - Intergenic
1074642605 10:115404401-115404423 ATGAGGAAACAGAGGGTGTATGG - Intronic
1074688102 10:115978277-115978299 CTGAGGACACATAGTGGGTAAGG + Intergenic
1074800379 10:116994498-116994520 CTGTAGAGACAGAGAGAGAAGGG + Intronic
1074863006 10:117527069-117527091 CTTAGGAAACAGACAGAGAAAGG + Intergenic
1075069706 10:119312871-119312893 CTGAGGACACAGAGCTGGCAAGG - Intronic
1075103035 10:119519317-119519339 CTGGGGACAGACAGGGAGACAGG - Intronic
1075333844 10:121595294-121595316 CTGAGGACAAAAATGGAGGAGGG + Intronic
1075362878 10:121855204-121855226 GTGTGGACACAGAGTGAGATTGG - Intronic
1075439727 10:122470279-122470301 ATGAGGAAACTGAGGCAGAAGGG - Intronic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1075808782 10:125209229-125209251 CTCAGGCCAGAGAGGGAGAAAGG + Intergenic
1076720957 10:132392905-132392927 ATGAGGACACTGAGGCACAAGGG + Intergenic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1076896653 10:133316539-133316561 CTTAGGACACAGAGATAGGAAGG + Intronic
1077177485 11:1197330-1197352 CTGAGGACCCAGCAGGAGTAGGG - Intronic
1077890295 11:6413436-6413458 CTGAGAACACAGAGGGAAGGGGG - Intronic
1077957417 11:7035723-7035745 AGGAGGACACAAAGGGAGAAGGG - Intronic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1079075573 11:17383583-17383605 ATGAGGACACAGGGTCAGAAAGG - Intergenic
1079081457 11:17416088-17416110 TTGGGGACAAGGAGGGAGAAAGG + Intronic
1079122445 11:17695701-17695723 CTGAGGACAGAGATGGAGGCCGG + Intergenic
1079303680 11:19303420-19303442 CTGAGGAGACGGAGAGAGATGGG + Intergenic
1080352488 11:31401448-31401470 AAGAGGAGACAGCGGGAGAAGGG - Intronic
1080370734 11:31638541-31638563 CTGACGAAAAGGAGGGAGAAAGG + Intronic
1080515730 11:33017697-33017719 CAGAGCACACAGAAAGAGAATGG - Intronic
1080646026 11:34188308-34188330 CTGAGGACACAGCAGGAACAGGG + Intronic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1081406504 11:42704930-42704952 ATGAGGACACAGATGGGTAAAGG - Intergenic
1081428975 11:42955335-42955357 CTGAGGACAAGGATGCAGAAGGG + Intergenic
1081703779 11:45168495-45168517 CGGAGGAGGCAGAGGGAGACAGG - Intronic
1081847782 11:46253143-46253165 CTAAGGTCACATAGGCAGAATGG + Intergenic
1082960363 11:58913619-58913641 CTGACACCATAGAGGGAGAAGGG + Intronic
1083108125 11:60378017-60378039 ATGAGGCCAAAGATGGAGAATGG + Intronic
1083412785 11:62505602-62505624 GAGAGGACTCACAGGGAGAAAGG - Intronic
1083609175 11:63997027-63997049 CTGCAGCCACGGAGGGAGAAAGG - Intronic
1083767238 11:64847430-64847452 CTGAGGTCACACAGGGAGTGAGG - Intergenic
1083946865 11:65928496-65928518 CTGGGGAGACTGAGGCAGAAAGG - Intergenic
1084038448 11:66527781-66527803 TGGAGCACACAGAGGGAGTAAGG + Intronic
1084234683 11:67779449-67779471 CTGATGACAGAGAGGCAGACGGG + Intergenic
1084324016 11:68388663-68388685 CTGAGCACCTAGAGGGAGGAAGG - Intronic
1084369230 11:68728014-68728036 CTGAGGACAGGGAGAGAGACAGG - Intronic
1084415366 11:69029264-69029286 TTTAGGAAACAGAGGGAGGAGGG - Intergenic
1084439252 11:69161968-69161990 GTGAGGACACAGGGAGAAAATGG + Intergenic
1084657471 11:70527803-70527825 CAGAGGACACCCAGGGACAATGG + Intronic
1084700387 11:70783078-70783100 ATGAGGACACAGAGAGACAGAGG + Intronic
1084757904 11:71251205-71251227 TGGAGCACCCAGAGGGAGAAAGG - Intronic
1085157277 11:74307318-74307340 CAGAGGACACTGAGGCACAAAGG + Intronic
1085196522 11:74675497-74675519 ATGAGGAAACTGAGGCAGAAAGG + Intergenic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086395967 11:86415297-86415319 CAGAGGACACAAAGAGAGTAAGG + Exonic
1086549554 11:88040286-88040308 GTGAGGACACAGGGAGAGGACGG - Intergenic
1087425919 11:97985242-97985264 CTGAGGGCAGGGAGGGAGACAGG + Intergenic
1088299522 11:108341467-108341489 CTGAGAACAGAGTGGGAAAAAGG - Intronic
1089005905 11:115090613-115090635 CTGAGGACACAGCGGGTCCAGGG + Intergenic
1089342500 11:117767999-117768021 GTGAGGACACAGAGGCAGTGTGG - Intronic
1089628792 11:119770527-119770549 GGGAGGACACAGAGGAGGAAGGG + Intergenic
1089812115 11:121140757-121140779 CAGAAGACACAGAGGGAAAGAGG - Intronic
1090776218 11:129968423-129968445 CTGAGGACAAAAACGGAGGAGGG + Intronic
1091291261 11:134441155-134441177 CTGAGGTCACAGTTGGAAAAGGG + Intergenic
1091311004 11:134575140-134575162 CTGAGGACACAGCGAGAAGACGG + Intergenic
1091383807 12:79144-79166 CCGAGAACACAGAGGGAGCTGGG + Intronic
1091843766 12:3638933-3638955 CTAAGGACACACAGTGAGTAAGG - Intronic
1092195882 12:6549536-6549558 CAGAGGAGAGAGAGGGGGAAGGG + Intronic
1092519529 12:9253663-9253685 CGGAGGGCACAAAGGGAGAGGGG + Intergenic
1092751119 12:11719976-11719998 CTGAGGCCACGGTGGGAGAGGGG - Intronic
1093376084 12:18429590-18429612 CTGTGGACTAAGAGGGGGAAGGG - Intronic
1093886455 12:24467044-24467066 CTGAGGAGACAGATAAAGAAAGG - Intergenic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1094504570 12:31050785-31050807 CTCATGACACAGATGAAGAAAGG - Intergenic
1094505191 12:31055538-31055560 CTGAGGATAAAGATGGAGAGAGG - Intergenic
1094526356 12:31233845-31233867 CTCATGAAAAAGAGGGAGAAAGG - Intergenic
1095535435 12:43240519-43240541 TTGAGAACACAGAGGGAGTGGGG - Intergenic
1096484562 12:51969774-51969796 CTGAGGAGGCTGAGGCAGAAGGG + Intronic
1096513010 12:52142208-52142230 CTGAGGTCACACAGGTAGATTGG - Intergenic
1096604104 12:52752741-52752763 CTCAGGACACAGATGGAGCTGGG - Intergenic
1097073681 12:56376273-56376295 GTGAGGACACAGTGAGAAAATGG - Intergenic
1097336902 12:58393988-58394010 CTGAGGAGACAAAGCAAGAAAGG + Intergenic
1097746749 12:63311634-63311656 CTGGGCTTACAGAGGGAGAAAGG + Intergenic
1098477499 12:70921659-70921681 ATAAAGACACAGAGGCAGAAAGG - Intergenic
1099511061 12:83537909-83537931 CTGAGCACACTGAAGGGGAATGG + Intergenic
1100171906 12:91984542-91984564 AGGAGGGCATAGAGGGAGAAAGG - Intergenic
1100633348 12:96409958-96409980 TTGAGGAAGTAGAGGGAGAAGGG - Intergenic
1100784427 12:98064150-98064172 CACAGGAAACAGAGAGAGAAGGG + Intergenic
1101881628 12:108629774-108629796 CTGAGGCCACACAGGTAGAAGGG + Intronic
1102012174 12:109625596-109625618 CTGAGGACAGAGAGGGCTTAGGG - Intergenic
1102579644 12:113878233-113878255 ATGAGGACACAGTGGCAGAGAGG - Intronic
1102653744 12:114462657-114462679 CTGAGGTTACAGAATGAGAACGG - Intergenic
1102697715 12:114813250-114813272 CTGAGGAAGCAGAGGAAGTAGGG - Intergenic
1103059784 12:117849100-117849122 TTGAGGACTAAGAAGGAGAAAGG + Intronic
1103081402 12:118026866-118026888 CTGTGTAGACAGAGGGGGAAAGG - Intronic
1103124553 12:118410153-118410175 CTGGGGACAAACAGTGAGAAAGG - Intronic
1103152384 12:118652001-118652023 CTAAGCAGAGAGAGGGAGAAGGG + Intergenic
1103231982 12:119339124-119339146 CTTAGGAAACAAAGGGAAAAGGG - Intronic
1103371458 12:120422701-120422723 CTGAGTCCAGAGAGGGCGAAGGG - Intergenic
1103905686 12:124326266-124326288 CTGAGGAGACAGAGGGTGGCCGG + Exonic
1103936725 12:124481087-124481109 CTGAGGAAGCAGGGGGTGAAGGG + Intronic
1103965751 12:124638313-124638335 GTGAGGACACAGTGGGAAGACGG + Intergenic
1104377352 12:128276547-128276569 CTGAGAACTCAGAAGGAGAAGGG - Intronic
1104411661 12:128563162-128563184 CAAAGGGCACAGAGGAAGAAGGG + Intronic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1104750352 12:131234516-131234538 CTGGGGACACAGAGGAATTAAGG - Intergenic
1104782369 12:131429946-131429968 CTGGGGACACAGAGGAATTAAGG + Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104856132 12:131903296-131903318 CCGGGGACACAGAGGGTGACTGG + Intronic
1105049646 12:133037317-133037339 CGAAGGACAAAGAGGAAGAACGG - Intronic
1105625465 13:22108393-22108415 CTGAGGACACAGAGCTTGAAGGG + Intergenic
1105864995 13:24451464-24451486 CGGAGGCCACAGAGGGACACTGG + Intronic
1106012291 13:25836505-25836527 GGGAGGACGCAGAAGGAGAAGGG - Intronic
1106777800 13:33025459-33025481 CTGGGCACACAAAGTGAGAAGGG + Intronic
1107015604 13:35706103-35706125 CTAAAGACACAGGAGGAGAAAGG + Intergenic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1108468064 13:50738902-50738924 ATGAGGATAGAGAGGTAGAAAGG - Intronic
1108548447 13:51519703-51519725 GTGAGGACACAGGGGGAAAGTGG + Intergenic
1110034681 13:70668356-70668378 ATAAGGACATTGAGGGAGAAAGG + Intergenic
1110399791 13:75076585-75076607 CTGAGGAAGCAGAGCTAGAAGGG + Intergenic
1110721752 13:78769462-78769484 TGGAGGCCACAGAGTGAGAAGGG + Intergenic
1111683022 13:91467295-91467317 CTGTCACCACAGAGGGAGAAAGG + Intronic
1112369750 13:98784395-98784417 GTGAAGACACAGGGGGAGGATGG - Intergenic
1112478910 13:99755944-99755966 CTTAGGAGGCAGAGTGAGAAAGG - Intronic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112639059 13:101252258-101252280 CAGAGAACAGAGAGGAAGAAGGG - Intronic
1112742533 13:102491502-102491524 CTGTGGGCACTCAGGGAGAAAGG + Intergenic
1113017110 13:105840268-105840290 CTGAGGACACAGCCAGAGGAGGG + Intergenic
1113148904 13:107240213-107240235 ATGAGGACACAGAGAGAAGATGG + Intronic
1113189055 13:107722627-107722649 CCTAGGACAGTGAGGGAGAAAGG + Intronic
1113665228 13:112136605-112136627 GGGAGGACAGAGAGGAAGAAAGG - Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114345668 14:21792056-21792078 CTAAGGACACAGCAGAAGAACGG + Intergenic
1114525410 14:23364836-23364858 ATGAGGAGTGAGAGGGAGAAGGG + Intronic
1116785540 14:49284414-49284436 CTGAGGCCAGAGAGGTAGAAGGG - Intergenic
1117243940 14:53864658-53864680 TTGAAGACTCAAAGGGAGAAGGG - Intergenic
1118293546 14:64547918-64547940 CTCAGGAGACTGAGGCAGAATGG + Intergenic
1118652514 14:67912626-67912648 GTGAGAACACAGAGGAAGAAGGG + Intronic
1118685998 14:68291861-68291883 CTGTGAACAGACAGGGAGAAGGG - Intronic
1119295594 14:73530490-73530512 TTGAGGGCAAAAAGGGAGAAAGG - Intronic
1119299242 14:73558218-73558240 TTGAGGGCAAAAAGGGAGAAAGG - Intronic
1119360492 14:74045036-74045058 CTGAGGAAACAGAAACAGAAAGG - Intronic
1119465979 14:74858966-74858988 CTGAGGAAACTGAGGCAGAGAGG - Intronic
1119662735 14:76463181-76463203 CAGAGGACGCAGGGAGAGAAAGG - Intronic
1119788299 14:77328645-77328667 ATGAGGAAACAGAGGGAAAATGG + Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1122211787 14:100178360-100178382 ATGATGCCACAGAGGGTGAATGG + Intergenic
1122375527 14:101254499-101254521 GTGAGGACACAGAGAGAAGACGG - Intergenic
1122783099 14:104151992-104152014 CTGAGGACAGCAAGGGACAAAGG - Intronic
1123024476 14:105418313-105418335 CTGAGGAGACAGAGGTAGGCTGG + Intronic
1123485241 15:20729800-20729822 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1123541729 15:21298849-21298871 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1124234579 15:27977842-27977864 ATGAGGACACAGTGAGAGAGCGG + Intronic
1124394950 15:29293353-29293375 CTCAGGAGGCTGAGGGAGAATGG - Intronic
1124787016 15:32690946-32690968 CTGAAGGCAGAAAGGGAGAAGGG - Intronic
1125485918 15:40110729-40110751 CAAAGGACAAAGAGGGAAAAGGG + Intergenic
1125535533 15:40439831-40439853 CTAAGGGCACAGAGAGAGATGGG - Intronic
1125591799 15:40858913-40858935 CCAAGGTCACAGAGGGAGCATGG - Intergenic
1125762399 15:42105498-42105520 CTGAGGACACCCAGGGAGGATGG + Intergenic
1125770087 15:42159440-42159462 CTGATGACACACAGGGAGAGTGG - Exonic
1126589312 15:50323465-50323487 CTGAGGACCCAGAGTGAGGCAGG + Intronic
1126694027 15:51310813-51310835 CAGAGGAAAGAGGGGGAGAAAGG + Intronic
1127323867 15:57874841-57874863 CTGAGGACAGACAGAGACAAAGG + Intergenic
1127634528 15:60856817-60856839 GTAAGGACAGAGAGGGAGAAGGG + Intronic
1127965700 15:63921354-63921376 CTGAGGAAACAGGGAGAGGATGG - Intronic
1128297837 15:66539977-66539999 CTGAGGACAAAGAGGTAAACGGG - Intronic
1128349543 15:66879891-66879913 CTGGGGAGCCAGAGGGAGATGGG - Intergenic
1128502954 15:68241594-68241616 CTGAGGACACTGAGAGACCAAGG + Intronic
1130145205 15:81268859-81268881 CTGAGGAAACTGAGGCAGAGAGG + Intronic
1130718832 15:86366033-86366055 CTGGGGACACAAAGGGCTAAAGG - Intronic
1131168940 15:90162867-90162889 CTGGGGAGATAAAGGGAGAAAGG - Intronic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1131531767 15:93199857-93199879 CTGAGGACCCAGAGAAGGAAAGG - Intergenic
1131757041 15:95576040-95576062 CCCAGGACACAGTGGGAGGATGG - Intergenic
1202950044 15_KI270727v1_random:25991-26013 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1133678692 16:8099832-8099854 CTGAAGAGAGAGAGAGAGAAGGG - Intergenic
1133918506 16:10130938-10130960 CTGAGGACTAAGAGGGACAGAGG + Intronic
1134365485 16:13573772-13573794 CTGTGGAGACAGTGGGATAATGG + Intergenic
1134912024 16:18036124-18036146 CTGGGAACACTGAGGGGGAAAGG + Intergenic
1135181842 16:20281592-20281614 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1135786168 16:25351176-25351198 CTGAGGACTCAAAGAGAAAAAGG - Intergenic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1136079309 16:27841165-27841187 CTGAGGACACAGAGGTGCAGAGG + Intronic
1136238882 16:28932323-28932345 CTGTGGAGAGAGAGGGAGAGAGG - Intronic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1137929652 16:52574933-52574955 ATGAGGACACTGAGGCAGTAAGG - Intergenic
1138006185 16:53340055-53340077 GTGAGTGCACAGAGGAAGAAAGG - Intergenic
1138495889 16:57409181-57409203 CTGGGGACATAGAGGAAGGAAGG + Intronic
1138778229 16:59751247-59751269 CTAAGGTCACAGAAGCAGAAGGG - Intronic
1139308826 16:66011196-66011218 CCCAGGAAACAGAGGGAGCATGG - Intergenic
1139335127 16:66226231-66226253 CCATGGACACCGAGGGAGAAGGG - Intergenic
1140193267 16:72836204-72836226 CGAAAGTCACAGAGGGAGAATGG - Intronic
1140457765 16:75114776-75114798 CTGAGGGCACCGTGGGAGCAGGG - Intronic
1140588212 16:76319803-76319825 CTAAGCCCACAGAGGGAGTATGG + Intronic
1140703656 16:77605970-77605992 CTTATGACACAAAGGAAGAAAGG + Intergenic
1140808175 16:78552783-78552805 CAGAGAGAACAGAGGGAGAAAGG - Intronic
1140818920 16:78645583-78645605 CAGAGAACATATAGGGAGAAAGG + Intronic
1141068166 16:80930715-80930737 CTCAGGAGACTGAGGCAGAATGG + Intergenic
1141069432 16:80939924-80939946 CAGAGGACAGTGTGGGAGAAGGG - Intergenic
1141381743 16:83583151-83583173 ATGAGAAGACACAGGGAGAAGGG - Intronic
1141502188 16:84451898-84451920 CTGAGGAGAGAGGGGGAGTAAGG - Intronic
1141703117 16:85651416-85651438 CTGAGGACAAACAGGGAGTCCGG - Intronic
1141749172 16:85946818-85946840 CTGAGGCCACTGAGGGTGAGAGG - Intergenic
1141805906 16:86341343-86341365 CTGTGGACACACAGGGAGCGCGG + Intergenic
1141859486 16:86706714-86706736 CTAAGGACACAGGATGAGAAAGG - Intergenic
1141988049 16:87592861-87592883 CTGAGGGCACTGTGGGGGAAGGG + Intergenic
1142482654 17:228347-228369 CTGAGCACACAGAGAGGTAAAGG - Intronic
1142612161 17:1115020-1115042 CTGAGGCCACAGAGGTAGGCAGG + Intronic
1143013898 17:3881553-3881575 CTGGGGACACAGGGAGGGAAAGG + Intronic
1143193766 17:5059713-5059735 CTGGGGAGAGGGAGGGAGAAAGG + Intergenic
1143741876 17:8960470-8960492 CTGAGGACACTGAGCAAGACAGG - Intronic
1144463675 17:15479309-15479331 GTGAGGAGACACAGGAAGAAGGG + Intronic
1144519311 17:15943968-15943990 CTGAGGACCCACAGGCAGAGAGG + Intergenic
1144579236 17:16448764-16448786 TTGAGGACACAGGAGGAGGAGGG + Intronic
1144809961 17:17992742-17992764 CTGGGGAGAAAAAGGGAGAAAGG - Intronic
1144835412 17:18154207-18154229 CTGAGTTCACTGAGGCAGAAAGG - Intronic
1144950749 17:18992245-18992267 CCAAGGACACAGAGGGAGGTGGG - Intronic
1146178058 17:30679467-30679489 GTGAGGACAGAGGGGGAGGATGG + Intergenic
1146470468 17:33120481-33120503 CAGATGACACAGAGGCAGAGGGG + Intronic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1146945239 17:36869158-36869180 CAGAGGTCACAGAGGGAGGAGGG + Intergenic
1147040946 17:37718585-37718607 CTTAGGAGGAAGAGGGAGAAGGG - Intronic
1148596778 17:48862753-48862775 CTGAGGATACAGTGGAAGACAGG + Intronic
1149060270 17:52413401-52413423 ATGAGGACACACAGAGAAAATGG - Intergenic
1149692116 17:58586256-58586278 TTGATGACAGAGAGAGAGAAGGG + Intronic
1149774521 17:59346704-59346726 TAGAGGATACAGAGGCAGAAAGG + Intronic
1150291822 17:63986825-63986847 ATGAGGACACTGAGGGACAGGGG + Intergenic
1150417137 17:64996799-64996821 CTGGGGACAGAGTGGCAGAATGG - Intergenic
1150794527 17:68227123-68227145 CTGGGGACAGAGTGGCAGAATGG + Intergenic
1150822920 17:68450247-68450269 CTGAGGACGTGGTGGGAGAAGGG + Intronic
1151510370 17:74555263-74555285 CTCAGGAAACAGAATGAGAAGGG - Intergenic
1151582648 17:74988842-74988864 CTGAGGACAGAAAGGGCGACTGG + Intronic
1151853898 17:76708490-76708512 TGGAGGACAGATAGGGAGAAAGG - Intronic
1151871650 17:76840832-76840854 CTGAGGGAACAGAGGGAGTCAGG - Intergenic
1152435040 17:80271350-80271372 CTGAGTACTCAAAGGGAAAAAGG + Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152475047 17:80512464-80512486 CAGAGGACACAGGGGGCCAAGGG + Intergenic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1153608484 18:6857702-6857724 CTAAGGACACAGTGTGTGAAAGG + Intronic
1153741310 18:8131557-8131579 CTAAGGACGCTGAGGGACAAAGG - Intronic
1155495181 18:26435829-26435851 CTGAGGACGCCCAGGGAGAGTGG - Intergenic
1157102381 18:44742700-44742722 CTAAGGACACAGAGGCAGGCTGG - Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157382545 18:47232560-47232582 CTGGGGACACAGAGGAGGGATGG - Intronic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157624866 18:49042746-49042768 GTGAGGACACAGAGTGTGACTGG + Exonic
1157719545 18:49913485-49913507 CTGAGGACACAGAGAAAGTGGGG - Intronic
1158487272 18:57878687-57878709 ATGAAGACACAGAGGAACAATGG + Intergenic
1158542660 18:58370818-58370840 GTCAGGAAACAGAGGGAGAGCGG - Intronic
1158933239 18:62341499-62341521 CTGAGGGGAGAGAGGGAAAAGGG - Intronic
1159053774 18:63445413-63445435 CTGAGGAGAGAGAGAAAGAAAGG + Intergenic
1159122512 18:64187248-64187270 CTGTGGAAACTCAGGGAGAATGG + Intergenic
1159579427 18:70218612-70218634 CTGAGGACACAGAGAGAAGATGG - Intergenic
1159879409 18:73844562-73844584 GTGAGGACACAGAGAGAAGATGG - Intergenic
1160118961 18:76109816-76109838 GTGAGGGCACAGTGGGAAAATGG - Intergenic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160149534 18:76388565-76388587 TTGATGACCCAGATGGAGAAAGG + Intronic
1160347888 18:78149855-78149877 CTGAGGAGAGGGAGGGAGATGGG + Intergenic
1160383654 18:78479795-78479817 CTGAGGAAAGAAAAGGAGAAAGG - Intergenic
1160400314 18:78605964-78605986 CTTAGGATGCAGAGGGAGGATGG - Intergenic
1160534684 18:79585718-79585740 GTGGGGACACAGTGGGAGCATGG - Intergenic
1160950996 19:1667410-1667432 CTGAGGTCACAGGGAGAAAACGG - Intergenic
1161122130 19:2534533-2534555 ATGAGGCCACAGGGTGAGAAAGG - Intronic
1161458340 19:4381278-4381300 CAGAGGGGACAGAGGGAGACGGG - Intronic
1161774532 19:6252188-6252210 CTAAGGCCACAGAGGGAGAGAGG - Intronic
1161975684 19:7606754-7606776 CTGAGGCCAGAGAGGCAGAGAGG - Intronic
1162038459 19:7955174-7955196 CTGAGGACACTGAGGTGGGAGGG + Intergenic
1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG + Intergenic
1162446792 19:10728307-10728329 CTGAGGCCAGAGAGGGAGACTGG + Intronic
1162461413 19:10816242-10816264 CTGAGGACATTGGGGGTGAAAGG + Intronic
1162641616 19:12014639-12014661 GAGAAGTCACAGAGGGAGAATGG - Intergenic
1163062607 19:14771318-14771340 CAGAGTACACAGAGTGGGAAGGG - Intronic
1163627978 19:18401859-18401881 CTGAGGACACAGTGAGAAGACGG - Intergenic
1163821637 19:19499541-19499563 CCCAGGATACAGAGGGAGGAGGG + Intronic
1164145331 19:22509435-22509457 ATGAGGACACAGACTCAGAAAGG + Intronic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165040189 19:33063596-33063618 CTCAGGACCTAGAGGGAGGAAGG + Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165700433 19:37933155-37933177 ATGAGGTCACACAGGGAAAATGG - Intronic
1165799048 19:38536474-38536496 ATGAAGACATAGAGGTAGAAAGG - Intronic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1166214323 19:41325612-41325634 CTGAGAACAGAGATGGAGAATGG - Intronic
1166806917 19:45492988-45493010 GGGAGGACCCAGAGGGAGCATGG - Intronic
1166864228 19:45826374-45826396 CTGAGGAGGAAGATGGAGAAGGG + Intronic
1167240851 19:48342245-48342267 GGGAGGAGAGAGAGGGAGAAAGG + Intronic
1167288016 19:48609810-48609832 CTGAGCACACTGAGGGAAAGTGG + Intronic
1167603757 19:50469137-50469159 GTGAGGGCAGAGAGGGAGCAAGG - Intronic
1167781189 19:51600331-51600353 CTGAGGTCACAGAGAGGCAAAGG + Intergenic
1168460042 19:56547209-56547231 GTGAGGACACAGAGAGAAGACGG - Intronic
925428493 2:3771132-3771154 CGGAGGATGCAGAGGGAGGACGG - Intronic
926269352 2:11353539-11353561 CTGAGGCCACAGAGGTAAAAAGG - Intergenic
926426884 2:12746361-12746383 GTGAGGACACAGCGGGAAAACGG - Intergenic
926976417 2:18520890-18520912 CTGAAGACACTGGAGGAGAAAGG - Intergenic
926988179 2:18646879-18646901 CTGAAGACCCAGAGAAAGAAAGG - Intergenic
927026308 2:19072470-19072492 CTGATGACACATCTGGAGAAAGG - Intergenic
927178870 2:20429637-20429659 GTGAGGACACAGGGAGAAAATGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927399677 2:22696520-22696542 TAGAGGACTCAGAGGGAGCATGG + Intergenic
927680185 2:25133770-25133792 CAGGGGACACAGAGGGGAAAAGG - Intronic
929443440 2:41984297-41984319 CTGAGGACAGAGGGTGATAAGGG + Intergenic
929578754 2:43068813-43068835 CTGAGGTCACACAGTCAGAAGGG + Intergenic
929886293 2:45881759-45881781 TTAAGGACACAGAGCCAGAAGGG - Intronic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
931341011 2:61400741-61400763 CTTAGGACACTGAAGGTGAAGGG + Intronic
931703985 2:64931875-64931897 GTGAGGACACAACGAGAGAATGG - Intergenic
932931853 2:76050631-76050653 CTGAGGACAGGCAGAGAGAAAGG - Intergenic
933886370 2:86721477-86721499 CTGATGACACCGAGGAGGAACGG + Intronic
934762801 2:96865633-96865655 CTGGGGACACCGAGGTAGGAGGG + Intronic
934771136 2:96908193-96908215 CTGAGCACACAGAGTGTGGACGG + Intronic
934908675 2:98229795-98229817 CTGAGGTCACAGAGCCAGGAGGG + Intronic
934983156 2:98864415-98864437 CTGGGGAAACACAGGTAGAATGG + Intronic
935224940 2:101045336-101045358 ATGGGGAGACAGAGAGAGAAAGG - Intronic
935729744 2:106055552-106055574 CTGAGGAGACAGAGAGTGAATGG - Intergenic
935867577 2:107407590-107407612 CAGAGGTGACAGAGGAAGAAAGG - Intergenic
936375748 2:111939971-111939993 CTGATTAGACAGAGGCAGAAGGG - Intronic
936396503 2:112135878-112135900 CTGAGGACAAAGACAGAGAAAGG + Intergenic
936616734 2:114055740-114055762 CTGAGGACACAGGGAGAAGATGG + Intergenic
937317383 2:120940607-120940629 CTGGGGTCACAGAGAGAGAATGG - Intronic
937342191 2:121098428-121098450 TTGAAGTCACACAGGGAGAAGGG - Intergenic
937381511 2:121381694-121381716 CTGAGCACACAGATCCAGAAAGG - Intronic
937701698 2:124869263-124869285 CTAAGGACAAACAGAGAGAAAGG + Intronic
937976815 2:127587487-127587509 ATGAGGACACAGAGAGAAGACGG - Intronic
939035560 2:137126895-137126917 CTGAGGAAAGAGAGAGAGATGGG + Intronic
939508807 2:143081497-143081519 CTGATGACCCAAAGGAAGAAAGG - Intergenic
939576445 2:143900965-143900987 GTGAGGAGACCGGGGGAGAAAGG + Intergenic
939722533 2:145672266-145672288 CTGAAGAAACAGAGGCAAAAAGG - Intergenic
939980649 2:148776775-148776797 GTGAGGACAAAGTGGGAGGATGG + Intronic
940065476 2:149622874-149622896 ATGATGACAGAAAGGGAGAAAGG - Intergenic
941036678 2:160576351-160576373 CAAAGGAGACAGAGGGAGACAGG + Intergenic
941589194 2:167397717-167397739 CTGAGAACACAGAGGTATACAGG - Intergenic
941755741 2:169183925-169183947 CTGAAAACACAAAGGCAGAATGG - Intronic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
942250020 2:174039620-174039642 ATGAGGACACTGAGGAAGAGAGG + Intergenic
942946966 2:181682759-181682781 CTGGGGACGGAGTGGGAGAAAGG + Intergenic
943381600 2:187156656-187156678 GTGAGGACACAGAGAGAGGATGG - Intergenic
945052158 2:205834391-205834413 CCGAAAACACAGAGGGAAAAGGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946392736 2:219426287-219426309 CTGAGGTCACAGAGGTGGGAGGG - Exonic
947004585 2:225496230-225496252 CTGAGGTTACAGAGGGAGTGAGG + Intronic
947442812 2:230138009-230138031 CAGAAGACACAGAGGGAGGTAGG - Intergenic
947615487 2:231554470-231554492 CTGAGTACACAGACGAAGGAAGG - Intergenic
948138787 2:235657922-235657944 GTGAGGACACAGGGGGAAGACGG + Intronic
948524845 2:238565096-238565118 GTGAGGACACAGCGGGAGGATGG + Intergenic
948571445 2:238920295-238920317 CTGAGGCCACTGTGGGAGCATGG - Intergenic
948587315 2:239027582-239027604 CTGAGGACCCAGGGCGAGCATGG + Intergenic
948625701 2:239266669-239266691 ATGTGGAGACAGAGGGAGAGAGG - Intronic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
948989492 2:241545622-241545644 AGGAGGACAGAGAGGGAGGAGGG + Intergenic
1168832562 20:854607-854629 CGGTGGACACTGAGGGAGGAGGG - Intronic
1168902548 20:1377390-1377412 CTGAGGACTAAGAGGTAGACAGG + Intronic
1169374570 20:5056218-5056240 TTGAGGACACAGAGAGACTATGG - Intergenic
1169712410 20:8579848-8579870 ATCAGGAGACAGAGGGAGCAAGG + Intronic
1169944544 20:10974773-10974795 CTCAGGAGGCAGAGGGAGATGGG - Intergenic
1170193965 20:13671594-13671616 CTCAGGACACTGGGGGAGAAGGG - Intergenic
1170309572 20:14977569-14977591 CTGAGGAAACTGAGGCAGAGAGG - Intronic
1170808431 20:19654454-19654476 CAGAGCATACAGAGTGAGAAGGG - Intronic
1171011817 20:21513157-21513179 TTAAGGAGAAAGAGGGAGAAGGG - Intronic
1171190275 20:23154036-23154058 GTGAGGACACAGAGAGAAGATGG - Intergenic
1171907738 20:30913903-30913925 CAGAAGACACAGAGAGAGACAGG - Intergenic
1171988334 20:31676334-31676356 ATGAGGAAACAGAGGCAGAGAGG + Intronic
1172009504 20:31838151-31838173 CTGAGGGCACACAAGGAGCAGGG + Intergenic
1172189561 20:33053839-33053861 CTGAGGACACAAAGGGGCCACGG - Intergenic
1172232854 20:33348608-33348630 CTGAGGAGCCAGAAGGAGCAGGG + Intergenic
1172304378 20:33870971-33870993 CTGAGGACACAGAGGCCCCAGGG + Intergenic
1172388189 20:34548398-34548420 TTGAGGTCACGGAGGGAGAAGGG + Intronic
1172444645 20:34986687-34986709 CTGAGGGCACTGAGAGTGAAGGG - Intronic
1172608230 20:36230091-36230113 ACCAGGACACAGAGGGTGAAGGG - Exonic
1172608605 20:36232377-36232399 CTGAGGCCCAAGAGGGGGAATGG - Exonic
1172650180 20:36497076-36497098 CTGAGGACACAGAGTGCAAAAGG - Intronic
1172837575 20:37882939-37882961 CTGAGGCCCCAGAAGGGGAAGGG + Intergenic
1172962675 20:38809482-38809504 ATGAGGACACTGTGGGATAAAGG + Intronic
1173104803 20:40123741-40123763 CAGAGGATAGAGAGGAAGAAAGG - Intergenic
1173140561 20:40478278-40478300 CTGAACACAGAGTGGGAGAATGG - Intergenic
1173443604 20:43098342-43098364 ATGAGGAAACTGAGGCAGAAGGG - Intronic
1173558522 20:43985128-43985150 CTGAGGGGACACAGGGAGAGAGG - Intronic
1173566613 20:44043366-44043388 CTGAGAACAGAGAGGTACAAAGG - Intronic
1173614661 20:44394903-44394925 CTAAGGACAGGGAGGGAGGAAGG + Intronic
1173622155 20:44444995-44445017 CTGAGGACACAGAGGCCACAGGG + Intergenic
1173639703 20:44592332-44592354 CAGAGGACACAGAGGAATCAAGG + Intronic
1173812273 20:45963390-45963412 CTGGTGCCACTGAGGGAGAATGG - Intronic
1173997925 20:47353698-47353720 CTGAGGAGGCAGAAGGAAAAAGG + Intronic
1174074088 20:47919831-47919853 ATGAGAACACAGAGAGAGAGGGG + Intergenic
1174089579 20:48036304-48036326 CTGAGGACACACAGCAAGTAAGG - Intergenic
1174204655 20:48829434-48829456 CTAAGGACACAGGGAGAGAATGG + Intergenic
1174429616 20:50458374-50458396 CTCAGGAGGCTGAGGGAGAATGG + Intergenic
1174743243 20:53037226-53037248 CTCAGGAAGCAGAGGCAGAAAGG + Intronic
1175247177 20:57589203-57589225 CTGAGGCCACACAGGGAGGCAGG + Intergenic
1175680988 20:60988726-60988748 GTGAGGACACAGCAAGAGAATGG + Intergenic
1175751266 20:61499579-61499601 CTGAGGTCACACAGGGAGGAGGG + Intronic
1175902123 20:62364072-62364094 CTGGGGACACAGCGGGAATAAGG - Intronic
1176077997 20:63257525-63257547 CGGAGGACAGTGATGGAGAACGG + Intronic
1176427664 21:6558761-6558783 CTGAGGACCCACAGGCAGAGAGG + Intergenic
1176984534 21:15420785-15420807 CTCAGGTCACTGAGGGAGGATGG + Intergenic
1177098929 21:16875186-16875208 CTGAGGACAGACAGAGACAAAGG + Intergenic
1177255430 21:18655736-18655758 CTCAGGACACAGAGGAGGCAGGG - Intergenic
1177421672 21:20867348-20867370 AGGGGGACAGAGAGGGAGAAAGG - Intergenic
1177849477 21:26329537-26329559 ATGAGGACACACAGGGAAAAGGG - Intergenic
1178601007 21:33994064-33994086 CTGAGGGCACAGGGGCAGACAGG + Intergenic
1178928981 21:36800556-36800578 GTGAGGAAACAGAGGCAGGAAGG + Intronic
1179164778 21:38926802-38926824 GTGAGGACACAGGGAGAGGACGG + Intergenic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1179540860 21:42082606-42082628 AGGAGGACACAGAGGGAGGAGGG - Intronic
1179703156 21:43167078-43167100 CTGAGGACCCACAGGCAGAGAGG + Intergenic
1179730940 21:43367057-43367079 CAGAGGACACAAAGGGCAAATGG + Intergenic
1179775581 21:43659773-43659795 GTGAAGACGCAGAGGGAGACAGG + Exonic
1179994090 21:44966030-44966052 CTGAGGACCCAGAGGAAGGGTGG + Intronic
1179997397 21:44980327-44980349 CTGAGGACAGCCAGGGACAAAGG - Intergenic
1180086263 21:45509284-45509306 AGGAGGACACAGATGGAGGAGGG + Intronic
1180140863 21:45892781-45892803 CTGAGGACACACAGGTTGAAGGG - Intronic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181235266 22:21444705-21444727 CTGAGGACTCAAACTGAGAAGGG - Intronic
1181332123 22:22100937-22100959 ATGATGACCCAGAGGGATAAAGG + Intergenic
1181362315 22:22347367-22347389 CCCAGGACACAGAGGAAGAGGGG - Intergenic
1181542447 22:23580528-23580550 CTGAGGTCACACAGGGAGGTGGG + Intergenic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1181802693 22:25357919-25357941 CTCAGCACCCAGAGGGAGGAAGG + Intronic
1181919464 22:26309403-26309425 TTGAGGACACTGAGGCTGAAAGG + Intronic
1182367628 22:29789499-29789521 ATGTGGCCCCAGAGGGAGAAAGG - Intronic
1182600387 22:31458696-31458718 CTGAAGCCACAGAGGGACACTGG - Intronic
1183068111 22:35377635-35377657 CAGAGGACAGAGAGAGAGACTGG - Intergenic
1183353936 22:37348685-37348707 CTGAGGACAGAGAGAGGGAAGGG - Intergenic
1183483767 22:38078520-38078542 CTGAGGACGCTGAGGCTGAAGGG - Exonic
1183522035 22:38301020-38301042 CTGGGGCCACAGAGGTGGAAAGG + Intronic
1183523602 22:38310732-38310754 CTTATGATGCAGAGGGAGAAGGG + Intronic
1184022347 22:41829211-41829233 CTGAGGACAGTGATGGGGAAGGG - Intergenic
1184085724 22:42262623-42262645 CAGAGATCACCGAGGGAGAAAGG + Intronic
1184233630 22:43171559-43171581 ATGTGGACACAGAGGGGGATGGG - Intronic
1184354212 22:43967782-43967804 CTGAGGACACAGAGAAGGAAAGG - Intronic
1184355361 22:43975917-43975939 ATGATGAGAGAGAGGGAGAAGGG - Intronic
1184748977 22:46473373-46473395 CTGAGGACATGGAGGAGGAAAGG + Intronic
1184983409 22:48112808-48112830 CGGAAGAGAGAGAGGGAGAAAGG + Intergenic
1184999837 22:48238617-48238639 CTGAAGCCTGAGAGGGAGAATGG + Intergenic
1185051669 22:48557325-48557347 GTGAGGACACAGAGAGAAGACGG + Intronic
1185061598 22:48609889-48609911 GTTAGGACACAGAGGGAGGACGG - Intronic
1185102623 22:48849826-48849848 GTGGGGACAGAAAGGGAGAAAGG + Intronic
1185181475 22:49365954-49365976 CTGAGCACACACAGTGAGGAGGG + Intergenic
1185181479 22:49365980-49366002 CTGAGCACACACAGTGAGGAGGG + Intergenic
1185181497 22:49366078-49366100 CTGAGCACACACAGTGAGGAGGG + Intergenic
1185361140 22:50407715-50407737 CTGTGGACACACAGGTAGAGAGG + Intronic
949678137 3:6481732-6481754 ATGAGGACAAAGAGGCAGAGGGG - Intergenic
949764819 3:7515029-7515051 CTAAGGACACAAAGGCTGAATGG - Intronic
949906734 3:8864220-8864242 CTGTGGAGAGAGAGGGGGAAGGG - Intronic
950249177 3:11449741-11449763 TTGAGGGCACAAAGGGGGAAAGG - Intronic
950467136 3:13162244-13162266 CTTGGAAGACAGAGGGAGAAGGG + Intergenic
950527025 3:13530226-13530248 CTGAGAAAACTGAGGCAGAAAGG - Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950722045 3:14890393-14890415 CGGAGGAAACAGTGGGAGCATGG - Intronic
951147650 3:19247877-19247899 TTGAGGCTACAAAGGGAGAATGG + Intronic
951549564 3:23863398-23863420 GGAAGGGCACAGAGGGAGAAAGG - Intronic
952084212 3:29798018-29798040 CTGAGGACAAAGAAAGAGATGGG + Intronic
952296362 3:32066118-32066140 CTGAAGAAAGAGAGAGAGAAAGG + Intronic
952909538 3:38170596-38170618 TTGAAGACACAGAGACAGAAAGG + Intronic
953383672 3:42492708-42492730 CTGGGGACCCAGGAGGAGAAGGG + Intronic
953494243 3:43372564-43372586 CTGAGGACTGAGTGGCAGAAAGG - Intronic
953793942 3:45968492-45968514 CTGCAGACAGAGAGGGAGAGGGG - Exonic
953862925 3:46560798-46560820 ATGATGAGACAGAAGGAGAACGG + Intronic
953896626 3:46808219-46808241 CTGAGTACCCACAGGGAGGAGGG - Intronic
954301699 3:49703840-49703862 CTGAGGGCACAGCGAGAGCAAGG + Intronic
954441346 3:50523956-50523978 CTGATGGCAGAGAGGGAGACAGG - Intergenic
954638693 3:52085380-52085402 GTGAGGAGGCAGAGGGTGAAGGG - Intronic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
955666364 3:61353579-61353601 CAGAGGGCACAAAGAGAGAAAGG + Intergenic
956268452 3:67424551-67424573 CAGAGGACACAGAGCTAGTATGG - Intronic
956651582 3:71509347-71509369 GTGATGACACAGAGGGAAGATGG - Intronic
957106751 3:75899459-75899481 CTGAGGTCACAGAGGTAGTCAGG - Intergenic
957167127 3:76689814-76689836 CTGACTACACACAGAGAGAACGG - Intronic
958426503 3:93984461-93984483 CTGAGGAGAAAGAGGAAGAGGGG + Intronic
958601360 3:96300012-96300034 CTTAAGTCAGAGAGGGAGAAAGG - Intergenic
958655528 3:96997520-96997542 CCAAGGAGACAGAGAGAGAAGGG + Intronic
958756773 3:98259500-98259522 CTCAGAACAGAGAGAGAGAATGG - Intergenic
959039113 3:101400662-101400684 CTGAGGAGAGAGAGAGAGATAGG - Intronic
959168020 3:102805145-102805167 ATGAGGAAACTGAGGGAGAAAGG + Intergenic
959557593 3:107739842-107739864 ATGAGGAAACTGAGGCAGAAAGG + Intronic
960165924 3:114401155-114401177 GGGAGGAGACAGAAGGAGAAAGG + Intronic
960553276 3:119000705-119000727 TTGAAGACTCAAAGGGAGAAGGG + Intronic
960729491 3:120710535-120710557 ATGTGGGCACAGATGGAGAAAGG - Intronic
960767922 3:121157941-121157963 CTGAGGAGCCAGTGAGAGAATGG + Intronic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
961466562 3:127085321-127085343 CTGAGGACACACAGCCAGCAAGG - Intergenic
961504684 3:127362359-127362381 ATGAGGACAGAGAGGCAGCAGGG - Intergenic
961511927 3:127408615-127408637 CTGAGGACACAGGGGAAGAGAGG + Intergenic
962390300 3:134966069-134966091 CTGGGTACACAGAGGGGCAAGGG + Intronic
962829309 3:139126114-139126136 CTGAGGAGACTGAGGCTGAAAGG + Intronic
962832731 3:139158573-139158595 CTGGGGGCACAGGGGGAGAAGGG + Intronic
963039460 3:141058066-141058088 CAGAGGCCACACAGAGAGAAGGG + Intronic
963616912 3:147551732-147551754 GTGAGGACACAGAGAGAAAGTGG - Intergenic
964003791 3:151807202-151807224 GAGAGGTCAGAGAGGGAGAAGGG - Intergenic
964136367 3:153349237-153349259 CTGAGGGTAAAGAGGCAGAAAGG - Intergenic
964769536 3:160210033-160210055 ATGAGGAGAGAGAGGGAGAGAGG - Intergenic
965080354 3:164024634-164024656 GAGAGGTCAGAGAGGGAGAAGGG + Intergenic
965370173 3:167852334-167852356 CTGAGTACACAAAGGGAAATAGG + Intergenic
965420332 3:168449945-168449967 GTGGGGAAACAAAGGGAGAATGG - Intergenic
965682479 3:171265746-171265768 CTGGGGAAACAGAGGGAAAGTGG + Intronic
965917961 3:173874001-173874023 GTGAGGACACAGTGGGACGATGG + Intronic
965928692 3:174015326-174015348 CTGAGGTCAGAGAGGCAGAATGG + Intronic
965962557 3:174445605-174445627 GTGAGGAAAGAGAGGTAGAAGGG - Intronic
966026266 3:175286850-175286872 GGGAGGCCACAGTGGGAGAATGG + Intronic
966126623 3:176584784-176584806 CTGAAGCAACAGAGGAAGAATGG + Intergenic
966164259 3:176999412-176999434 CTGAGGATATAGAGGCAAAAAGG + Intergenic
966716655 3:183019478-183019500 GTGAGGACACAGAGAAAAAATGG + Intronic
966915065 3:184580113-184580135 CTGAGGTCACACAGGCAGTAAGG - Intronic
967019523 3:185510302-185510324 CTGTGGACAGAGAGGGAGACAGG - Intronic
967081026 3:186049597-186049619 CTGGAGACGCAGAGGGGGAAGGG + Intronic
967491847 3:190101140-190101162 CTGAGGACAGGGAGAGAGACAGG - Intronic
967732900 3:192922450-192922472 ATGAGGGCACAGAAAGAGAAGGG + Intergenic
968784296 4:2608284-2608306 CTCAGGAGACTGAGGCAGAAGGG - Intronic
969070759 4:4536663-4536685 GTGAGGCCAGAGAGGGAGCAGGG + Intronic
969370592 4:6728761-6728783 CTGAGGACACAGGGCAAGCAGGG - Intergenic
969489456 4:7490857-7490879 CAGAGGGCACAGAGGAAGCAGGG - Intronic
969650757 4:8466581-8466603 CAGAGGACACAGAGGATGACGGG - Intronic
970659069 4:18264251-18264273 CTGGAGACACAGAGAGTGAAGGG + Intergenic
971146757 4:23985306-23985328 CTGATGAGAAAGAGTGAGAAGGG + Intergenic
971218070 4:24680487-24680509 CTGCTGAAAAAGAGGGAGAAGGG + Intergenic
971397319 4:26240825-26240847 TTGATGAGAAAGAGGGAGAAAGG + Intronic
971424326 4:26501343-26501365 GTGAGGCCACAGAGGGAGGCAGG - Intergenic
971527545 4:27639860-27639882 CTGTGGATACAGAGGGACAGAGG - Intergenic
971569156 4:28187748-28187770 CTGAGGACAGGGAGAGACAAAGG - Intergenic
972383714 4:38543340-38543362 CTGAGGAGAAGGAGGGAGATGGG + Intergenic
972694125 4:41427978-41428000 CTGAATACACAGAGGTAAAAAGG - Intronic
973325130 4:48852985-48853007 CTCAGGAGACTGAGGCAGAATGG - Intronic
973839468 4:54846278-54846300 GTGAGGACACAGAAAGAAAATGG - Intergenic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
974853132 4:67427652-67427674 CTAAGGTCACAGAGTTAGAAAGG - Intergenic
975181407 4:71350003-71350025 CTGAGGACATGTATGGAGAAAGG + Exonic
975323600 4:73035915-73035937 CAGAGGACACACAGGGAAGAAGG - Intergenic
976260049 4:83136778-83136800 CTGGGGACCCAGAGTGTGAAGGG - Intronic
978123049 4:105104470-105104492 CTGAGGAGAGTGAGGGAGATGGG + Intergenic
978481226 4:109192915-109192937 GTGAAGACACAGAGAGAGCATGG + Intronic
978588381 4:110297351-110297373 CTCTGGACAAAGAGGGTGAAGGG + Intergenic
978826342 4:113028556-113028578 CTAAGGACACAGTGGAACAAAGG + Intronic
979212346 4:118120318-118120340 CTCAGGAGGCAGAGGGAGCAGGG + Intronic
979448831 4:120844618-120844640 CTGAGGAGAGAGAGAGAGATGGG - Intronic
980192826 4:129546302-129546324 ATGAGGAGGAAGAGGGAGAAAGG - Intergenic
980968414 4:139546092-139546114 CTGAGGACACTGAGAGGGAGAGG - Intronic
981058714 4:140395945-140395967 ATGAAGACACGGATGGAGAATGG - Exonic
981491915 4:145348679-145348701 CAGAGCCCACAGAAGGAGAATGG - Intergenic
981680884 4:147396551-147396573 CTGAGGTCACAGAGATAGTAAGG + Intergenic
982326995 4:154138047-154138069 AGGAGCACAAAGAGGGAGAAGGG + Intergenic
983290466 4:165797756-165797778 GTGAGTACACAGAGGGGAAAGGG + Intergenic
983921283 4:173347948-173347970 CTCATGACACTGAGGCAGAAGGG + Intergenic
984210078 4:176836590-176836612 CTGAGGACACAGCGAGAAGATGG + Intergenic
984769605 4:183425945-183425967 CTGAGGACACAGGAGGGGGAGGG - Intergenic
985282367 4:188300119-188300141 CTGAGGAAGCAGAGGGAACAGGG - Intergenic
985899553 5:2777995-2778017 CTGAGGACACAGGGAGACGAGGG + Intergenic
985950125 5:3216621-3216643 GTGAGGACAGAGAGGGTGACAGG + Intergenic
986197470 5:5551303-5551325 GTCAGGAGAGAGAGGGAGAAGGG + Intergenic
986203005 5:5596292-5596314 CAGAAGGCAAAGAGGGAGAAAGG - Intergenic
986736005 5:10667750-10667772 CTGAGGCCCCAGAGGGAGCATGG - Intergenic
986776435 5:11018293-11018315 CTGAGGAGAGAGAGGAGGAAGGG - Intronic
988434523 5:31158318-31158340 TTGAGGACGCAAAGGAAGAAAGG - Intergenic
988655521 5:33207306-33207328 CTGAGGAGAGGGAGAGAGAAGGG - Intergenic
988669768 5:33368837-33368859 CTGAGGAGAGGGAGAGAGAAAGG + Intergenic
988889451 5:35599016-35599038 CTGTGGCCACTGAGGGGGAAGGG - Intergenic
990432453 5:55749644-55749666 GTGAGGACAGAGTGGGAGGAAGG - Intronic
990468226 5:56089127-56089149 CTGGGAACACAGGAGGAGAAAGG - Intergenic
990788767 5:59453243-59453265 CTGAGGAGAAAGAGAGAGATAGG - Intronic
990849660 5:60188460-60188482 AGGAGGAGACAGATGGAGAAAGG - Intronic
990902400 5:60766859-60766881 CTGGGGTTAGAGAGGGAGAATGG - Intronic
990987009 5:61649890-61649912 CAGATGACACAGAAGGAGAGGGG - Intronic
991503691 5:67302961-67302983 CACTGGACAGAGAGGGAGAAGGG + Intergenic
992232106 5:74673548-74673570 CGGAGGACACACTGGGAGGAGGG - Intronic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992846606 5:80755647-80755669 CTGAGGGAACAGATGGAAAAAGG + Intronic
993025195 5:82637303-82637325 TGGAAGACACACAGGGAGAAGGG - Intergenic
993368758 5:87065449-87065471 CTGAGGAGAGAGAGAGAGATGGG + Intergenic
993531367 5:89028768-89028790 CTGATTACACAGAAGCAGAAGGG - Intergenic
995164080 5:109016963-109016985 GTGAGGACACAGTGGGAAGAAGG + Intronic
995379019 5:111512076-111512098 CTGAGGACACTGAGGTCTAATGG + Intronic
995396898 5:111696742-111696764 GTGAGGACACAGAGAGAAGATGG - Intronic
996273705 5:121639500-121639522 CTAAGGAGGGAGAGGGAGAATGG + Intergenic
996474919 5:123906526-123906548 CTCAGGAGACAGAGAGAGAAGGG + Intergenic
996633161 5:125661611-125661633 ATGAGAACAGGGAGGGAGAAAGG - Intergenic
997487940 5:134247697-134247719 ATGAAGGAACAGAGGGAGAAAGG + Intergenic
997701986 5:135908935-135908957 ATGAGGAAACAGAGGTAGAGAGG + Intergenic
997804713 5:136905720-136905742 CTGAATACACAGAGGCAGACAGG - Intergenic
998581720 5:143384114-143384136 AGGAGGAGACAGAGAGAGAAGGG + Intronic
998667807 5:144318114-144318136 TTGAGGAGACTGAAGGAGAAGGG + Intronic
999230078 5:150056578-150056600 CAGAGGACAAAGGGTGAGAAGGG - Intronic
999371334 5:151057018-151057040 ATGAGGAAGCAGAGGGAGAATGG - Intronic
999691502 5:154149904-154149926 CTGTGGATACAGAGGGACAGAGG + Intronic
999802478 5:155050837-155050859 CTGAGGACACAGCAGAGGAAAGG - Intergenic
999845242 5:155472129-155472151 CTGAGGACACAAAGATAGATAGG + Intergenic
999852560 5:155558669-155558691 CTGAGGAAACAGAGTCAGAGAGG + Intergenic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000287847 5:159843080-159843102 CTGAGGATATTGAGGGACAACGG + Intergenic
1000453804 5:161423627-161423649 CTGAGGAGAGAGAGAGAGATAGG - Intronic
1000766939 5:165303525-165303547 CTGAGGATGCAGAGGCAGATAGG - Intergenic
1000801349 5:165730383-165730405 CTGAGGAGACAGAAGAGGAAGGG - Intergenic
1000919257 5:167119100-167119122 ATGAGGAAACTGAGGCAGAAAGG - Intergenic
1001275393 5:170347068-170347090 TGGAGGCAACAGAGGGAGAAAGG + Intergenic
1001581694 5:172802891-172802913 CAGAGGACACAGTGAGAAAATGG + Intergenic
1001956408 5:175850930-175850952 CTGAGGAACCAGAGGCAGGAGGG + Intronic
1002018781 5:176348149-176348171 CTGTGGTTTCAGAGGGAGAAGGG - Intronic
1002176789 5:177405186-177405208 CTGGGGACAAAGAGGGATAGTGG + Intronic
1002438894 5:179253761-179253783 CTGAGGCCAAAGGGTGAGAAGGG - Intronic
1002439286 5:179256021-179256043 CTGGGGACAGAGAAGGAGACTGG - Intronic
1002453196 5:179331265-179331287 GAGAGGACATAAAGGGAGAATGG + Intronic
1002839484 6:893749-893771 CTGTGGGGACAGAGGAAGAAAGG - Intergenic
1003400300 6:5785150-5785172 CAGAGGATACAGCAGGAGAAGGG + Intergenic
1003613334 6:7632589-7632611 CTGAGACCACACAGAGAGAAAGG + Intergenic
1004233243 6:13851487-13851509 CTGAGGAGGCAGAAGGACAAAGG - Intergenic
1004620359 6:17325919-17325941 GAGAGGTCAGAGAGGGAGAAAGG + Intergenic
1005676926 6:28164385-28164407 CTGGGGAAACTGAGGAAGAAGGG - Intergenic
1005893943 6:30162533-30162555 CTGATCACCCAGTGGGAGAATGG + Intergenic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006535421 6:34695874-34695896 CTGAGGATAGATAGGGAAAAGGG - Intronic
1007443532 6:41885689-41885711 CTGAGGAGGCTGAGGCAGAATGG + Intronic
1007649036 6:43405894-43405916 TTGAGGAAAGAGAGGGGGAAGGG + Intergenic
1007670981 6:43553571-43553593 CAGAAGACACAGAGAGACAATGG + Intronic
1007702803 6:43774318-43774340 CTGAGGACAGAAAGAGAGCAAGG - Intronic
1008009858 6:46454863-46454885 CTGAGGACATAGAAGGACAGGGG - Intronic
1010064805 6:71669825-71669847 CTGAAGAAACAGAGAGAGATGGG - Intergenic
1010651857 6:78464990-78465012 GTAGGGACACAGAGGGAAAAAGG - Intergenic
1012067090 6:94561430-94561452 CTGAGGCCACAGAGGTAGGAAGG - Intergenic
1012298191 6:97550396-97550418 CTCAGGAGGCTGAGGGAGAATGG + Intergenic
1012868381 6:104644814-104644836 CTGAGGACACGGAGGTAGCAAGG - Intergenic
1013491651 6:110652747-110652769 ATGAAGACACAGAGAGAGAAAGG + Intronic
1013629016 6:111967145-111967167 TTGTGGACCCAGAGGTAGAAAGG + Intergenic
1013805234 6:113989405-113989427 GTGAGGACACAGAGAGAAGAGGG - Intronic
1013911655 6:115282680-115282702 CTGAGGCCCCAGAGGGAGGGTGG - Intergenic
1014106465 6:117569330-117569352 GTGAGGACACTGAGGGACAGAGG + Intronic
1014688636 6:124533870-124533892 GTGAGGACACAGAGGGAAGATGG - Intronic
1015901465 6:138072405-138072427 TTGTGGAGACAGAGGGAAAATGG + Intergenic
1016317377 6:142805490-142805512 AAGAGGACACAGAGAGACAAAGG + Intronic
1016839001 6:148507168-148507190 CAGAAGACAGAGTGGGAGAAGGG + Intronic
1016945388 6:149527632-149527654 ATGAGGAGGCACAGGGAGAATGG - Intronic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1018304499 6:162441073-162441095 CTGAGGACACTGAAAAAGAAAGG - Intronic
1019315496 7:382436-382458 CTGAGGACACAGCAGTAGAATGG + Intergenic
1019587711 7:1814116-1814138 CTGTGAACACAGAGGGACAGGGG - Intergenic
1019838119 7:3411131-3411153 CGGAAGACCAAGAGGGAGAAGGG + Intronic
1020079043 7:5276704-5276726 CTGCGGAGGCAGAGGGAGAGGGG - Intronic
1020944549 7:14585944-14585966 CTGAGGACACAAAGAGAGACAGG - Intronic
1021089138 7:16461404-16461426 GAGAGGAGACAGAGGGAGACAGG - Intergenic
1022047924 7:26638213-26638235 CCCAGGACACATAGGGATAATGG - Intronic
1022174719 7:27862062-27862084 GGGAGGATACAGAGGGGGAAAGG + Intronic
1022539960 7:31126170-31126192 GTGAGGACACAGAGAGAAGACGG + Intergenic
1022863985 7:34398385-34398407 GTGAGGACACAGAGAGAAGATGG - Intergenic
1023178650 7:37458585-37458607 CTGAGCAAACAAAGGAAGAAAGG - Intergenic
1023231700 7:38038575-38038597 CTAAGGGCACAGAGTGAGTAGGG + Intergenic
1023895646 7:44430933-44430955 CTGAGGACACGGCAGGAGGATGG - Intronic
1024123828 7:46271381-46271403 CTGAGAACCCAGAGGGAGAGGGG - Intergenic
1024244678 7:47460281-47460303 GTGAGGACACAGGGAGAAAACGG + Intronic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024365064 7:48510710-48510732 GTGAGGACACAGGGAGAGGATGG - Intronic
1024457985 7:49630674-49630696 GTGAGGACACAGAGAGTGGACGG - Intergenic
1024554616 7:50592834-50592856 CTGGGGACCCAGAGCGAGATGGG - Exonic
1024628312 7:51227321-51227343 CTCAGGAGACAGAGGAAGACTGG + Intronic
1024729366 7:52237007-52237029 ATGAGGAGAGAGAGAGAGAAGGG - Intergenic
1024787800 7:52928244-52928266 ATGAGATCACAGAGGGAGAGTGG - Intergenic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025981625 7:66411904-66411926 CTGATCACTCAGAGGGGGAAAGG + Intronic
1026280715 7:68919524-68919546 CTGAGGACAAAAGGGGAGATTGG + Intergenic
1026325508 7:69305977-69305999 CTCAGGAGACTGAGGCAGAAGGG - Intergenic
1026418234 7:70205288-70205310 CTCAGGAGACAGAGGCAGGAGGG - Intronic
1028004474 7:85546167-85546189 CAAAGGACACAGAGGAAAAAGGG - Intergenic
1028178309 7:87683541-87683563 CTGAGGAGAAAGAGAGAGATGGG + Intronic
1028202342 7:87976424-87976446 GTGAGGACACAGAGAGAAAATGG + Intronic
1029363593 7:100103484-100103506 CTGAGGTCAAAGAGGCTGAAGGG - Exonic
1029843968 7:103394173-103394195 GTAAGGAAACAGAGGAAGAAAGG + Intronic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1030648269 7:112088810-112088832 ATGAGGAAACTGAGGGACAAAGG - Intronic
1031192763 7:118575723-118575745 ATGAGGTCAGAGAGGGAGCAGGG + Intergenic
1031569438 7:123341007-123341029 CTGAGGACAGAGAGAAAGGAGGG - Intergenic
1031766677 7:125786824-125786846 GTGAGGACACAGTGGGGGGATGG - Intergenic
1031972565 7:128075038-128075060 CTGAGGGCACTGACAGAGAAGGG - Intronic
1032025007 7:128434252-128434274 CTGAGGACACATGGGGATTATGG + Intergenic
1032503234 7:132415626-132415648 AGGAGGAGAAAGAGGGAGAAAGG - Intronic
1032746304 7:134790110-134790132 GAGAGGACAGAGAGGGAGGAAGG + Intronic
1033150893 7:138914073-138914095 CGGGGGAAACAGAGGCAGAATGG + Intronic
1033247781 7:139732622-139732644 CTGAGATCACAGAGCTAGAAAGG - Intronic
1033478654 7:141716338-141716360 GGGAGGAGAGAGAGGGAGAAGGG - Intronic
1033585353 7:142770758-142770780 CTGAGAGCAGAGAGGGAGACCGG - Intergenic
1033767948 7:144515199-144515221 CTGGGCACACAGAGAAAGAAAGG + Intronic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034337141 7:150330885-150330907 CTGCTGGCCCAGAGGGAGAAGGG + Exonic
1034391145 7:150788549-150788571 CTGAGGACACAGGGAGAAGACGG - Intergenic
1034399485 7:150852653-150852675 AACAGGACACAGAGGGAGGAGGG + Intronic
1034492509 7:151401365-151401387 CTGAGGAAACAGAGGGTTTAGGG - Intronic
1034516568 7:151585522-151585544 CTGAGAACAGGGAGGGAGAATGG - Intronic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1034936961 7:155206479-155206501 GTGAGGACACAGGGAGAGGATGG - Intergenic
1034962263 7:155370305-155370327 CTGAGGAAACTGAGGCACAAAGG - Intergenic
1035028994 7:155845085-155845107 CTGTGGTCACAGAGAGAGAGAGG + Intergenic
1035090258 7:156304556-156304578 CTGCAGATACAGAGCGAGAACGG - Intergenic
1035207242 7:157301828-157301850 GTGAGGACACAGAGGGCCAAGGG - Intergenic
1036064899 8:5368999-5369021 AGGAGGTCACAGAGGGAGAAAGG - Intergenic
1036067375 8:5397141-5397163 ATGAGGACACAGTGAGAAAATGG + Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036478188 8:9113395-9113417 CTGAGGAGAGGGAGGGAGATTGG + Intronic
1036575912 8:10027551-10027573 CTGAAGACCCAGAGGTACAAGGG + Intergenic
1036685111 8:10904399-10904421 CCGATGACACAGAGCCAGAAAGG + Intronic
1037035421 8:14160714-14160736 GTGAGGACACAGAAGTAAAATGG - Intronic
1037305552 8:17499419-17499441 CTGAACACACAGAGAGAGAAGGG - Intronic
1037315885 8:17599084-17599106 ATGTGGATAAAGAGGGAGAAGGG - Intronic
1037466054 8:19161781-19161803 CTGTGGCCAGAGAGGCAGAAGGG + Intergenic
1037612038 8:20483994-20484016 AAAAGGACACAGAGGGAGAAAGG - Intergenic
1037645245 8:20787139-20787161 GTGAGACCAGAGAGGGAGAAGGG + Intergenic
1037759668 8:21733513-21733535 TTGAGGAGAGAGAGGGCGAAGGG + Intronic
1037788093 8:21914618-21914640 CTGAGGTCACAGAGGTAGTTGGG + Intergenic
1037928416 8:22863276-22863298 CTTAGGACACACAGAGAGGAAGG - Intronic
1037949279 8:23008118-23008140 CTGAGGACACAAAGGGGGGAAGG + Intronic
1037949696 8:23010846-23010868 ATGAGGACACAGAGTGAAGAAGG + Intronic
1038378703 8:27070936-27070958 CTGAGGCTACAGAGGTAAAATGG + Intergenic
1038458674 8:27697150-27697172 CTTAGGACACACTGGAAGAAAGG - Intergenic
1038777121 8:30541207-30541229 ATGAGGAAACAGATGCAGAAAGG - Intronic
1039727410 8:40233751-40233773 GTGAAGACACAGAGACAGAATGG + Intergenic
1039793935 8:40896611-40896633 CGGAGGAGGCAGGGGGAGAAAGG + Intronic
1040396686 8:47007410-47007432 CTCAGGACAAAGAGAGAGAAGGG + Intergenic
1040546485 8:48401885-48401907 CTGAGGCCAGAGATGGGGAATGG - Intergenic
1040973444 8:53163444-53163466 CTGAGGATACAGAGCCAGGACGG - Intergenic
1041277492 8:56177884-56177906 CTGGGGACACAGAAGCAGTACGG - Intronic
1041289975 8:56299438-56299460 CTGAGGAAACAGAAGGACACAGG - Intergenic
1041724642 8:61006550-61006572 CTGAGCAGACAGATGAAGAAGGG + Intergenic
1042025064 8:64414589-64414611 ATTGGGAGACAGAGGGAGAAGGG - Intergenic
1042420662 8:68584881-68584903 CTGTGGAGCCAGAGGGAGAAGGG - Intronic
1042499780 8:69496076-69496098 CTGAGCACAGAAAGGGTGAAAGG - Intronic
1043378207 8:79673633-79673655 CTGAGGAAACAGAGGCCAAAGGG - Intergenic
1043655386 8:82658819-82658841 ATGAAGAAAAAGAGGGAGAATGG - Intergenic
1044030890 8:87235507-87235529 CTGAGGACAGGGAGAGAGATGGG + Intronic
1044044103 8:87408927-87408949 CTGAGGAGAGAGAGAGAGATGGG - Intronic
1044089787 8:87984986-87985008 CTGAGGAGACAGAGAGAGATGGG + Intergenic
1045033683 8:98161479-98161501 CTGAGGACACAGAGGAATACAGG + Intergenic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1045968745 8:108055992-108056014 CTGAGGGACCAGAGGGTGAATGG - Intronic
1046330005 8:112701810-112701832 CTCAGGGCACAGAGGTTGAAAGG - Intronic
1046351712 8:113023723-113023745 GTGAGGACAGAGAAGGAGATTGG - Intronic
1046637223 8:116683377-116683399 CTGAGGACACAGTGAGAAAATGG - Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047078600 8:121434056-121434078 CTGAGGTAACAGATGGAGTAGGG + Intergenic
1047193544 8:122700495-122700517 CTGAAGACACAGGGAGAGGATGG + Intergenic
1047489304 8:125361537-125361559 ATGAGGAAACTGAGGCAGAAAGG - Intronic
1047531081 8:125676013-125676035 CTAAGGAAACAGCAGGAGAATGG + Intergenic
1047549848 8:125858859-125858881 ATGAGGAAACTGAGGCAGAAAGG + Intergenic
1048043007 8:130748960-130748982 CTGGGGCAAGAGAGGGAGAAGGG + Intergenic
1048286239 8:133143810-133143832 TTTAGGACACAGAGCTAGAAAGG - Intergenic
1048635126 8:136287073-136287095 GTGAGGACACAGTGTGAGGATGG + Intergenic
1048646035 8:136420796-136420818 CTGTAAACACCGAGGGAGAATGG + Intergenic
1048838900 8:138547461-138547483 GAGAGGAGACAGAGGGAGACAGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048936921 8:139365141-139365163 GTGAGGACACAGAGAGAAGACGG - Intergenic
1048952666 8:139509217-139509239 TTGAGGACACAGAAGGAATAGGG + Intergenic
1048979665 8:139696619-139696641 CTGAGTACACAGAGGAGGGAGGG + Intronic
1049157152 8:141074074-141074096 CTGGGGACACAGAGGTGGATGGG + Intergenic
1049417243 8:142500653-142500675 CTGAGGTCAGAGAGGGAGGGTGG + Intronic
1049446547 8:142634089-142634111 GCGAGGAGCCAGAGGGAGAAGGG + Intergenic
1049469840 8:142770395-142770417 GGGAGAACACAGAGGGAGCATGG + Intronic
1049574082 8:143382475-143382497 CTAAGGAGCCAGAGGGAGCATGG + Exonic
1050003077 9:1099209-1099231 CAGAGGACAGGGTGGGAGAAAGG - Intergenic
1050301132 9:4260010-4260032 ATGGAAACACAGAGGGAGAAAGG + Intronic
1051027967 9:12636750-12636772 CTGAGGAAACAGTGGTGGAAAGG - Intergenic
1051057215 9:13001774-13001796 TTGAAGACACAGAGGGAGCCAGG - Intergenic
1051552538 9:18346091-18346113 CTGAGGAAACAGAAGGCTAATGG - Intergenic
1051730636 9:20139286-20139308 CTGAGGACTCACAGGGAGTAAGG - Intergenic
1051857175 9:21581856-21581878 CTGAGGGAACAAAAGGAGAAAGG - Intergenic
1052216368 9:25971691-25971713 CTGAGAAAACAGAGGCAGAAGGG - Intergenic
1052901055 9:33795342-33795364 CTGAGAGCAGAGAGGGAGACTGG - Intronic
1053103307 9:35389816-35389838 CAGAGGACACAGTGAGAGAGAGG - Intronic
1053188407 9:36037849-36037871 ATGAGTGCACAGAGGGAGAGAGG + Intronic
1053316103 9:37053002-37053024 CTGAGGACAGAGAGGGATAGAGG - Intergenic
1053848496 9:42266387-42266409 CTGAGAACAGGGAGGTAGAAGGG - Intergenic
1054974092 9:71121821-71121843 GTGAGGACACAGGGAGAGAAGGG + Intronic
1055667619 9:78568408-78568430 ATGAGGAAACACAGGGAGCAAGG + Intergenic
1055854535 9:80669988-80670010 CCCAGGCCAAAGAGGGAGAAGGG - Intergenic
1056131014 9:83586514-83586536 CTCAGGCCACAGAGGCAGGAAGG + Intergenic
1056388574 9:86119468-86119490 GTCAGGAGACAGAGGGAGCAAGG + Intergenic
1056718320 9:89052239-89052261 CTGAGGACACAGGGACAGAGAGG + Intronic
1056808988 9:89749914-89749936 CTGAGGTCACACAGTGAGGATGG + Intergenic
1056877063 9:90343646-90343668 CTAAGAACAAAGAGGCAGAAAGG - Intergenic
1056884698 9:90429966-90429988 CTAAGGAAACAGGGGAAGAAAGG + Intergenic
1057815858 9:98294012-98294034 TAGAGAACACAGAGGGATAATGG - Intronic
1058025030 9:100133260-100133282 CTGAGGAGACAGGGAAAGAAGGG - Intronic
1058132181 9:101265555-101265577 CTCAGGACAGGGAGGAAGAAAGG + Intronic
1058460158 9:105175073-105175095 GTGAGGAAGCTGAGGGAGAAAGG - Intergenic
1058887907 9:109336690-109336712 CTGAGAAGACAGAGGCAGAGAGG - Intergenic
1059241258 9:112807825-112807847 ATAAGAACACAGAGGGAAAAAGG - Intronic
1059366322 9:113789244-113789266 CTGAGGACACTGAGAGACCAAGG - Intergenic
1059754163 9:117276689-117276711 CTGAGGGCACAGAGAGACAAGGG + Intronic
1059880678 9:118685615-118685637 CTGAGGAAACAGAGAGGGCATGG + Intergenic
1059943518 9:119381948-119381970 CTAAGAAAACACAGGGAGAAAGG - Intergenic
1060117797 9:120957995-120958017 CTGAGGCCACATAGAAAGAATGG - Intronic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1060918191 9:127403518-127403540 CTGAGGACACAGGGGGTGCTGGG + Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061091945 9:128431531-128431553 CTGAGAACACAGAGGAGGACAGG + Intronic
1061404522 9:130385987-130386009 CTGAGGAAACCGAGGCAGGAAGG - Intronic
1061493640 9:130959630-130959652 TTGAGGTCCCAGAGGGAGATTGG + Intergenic
1061542848 9:131287598-131287620 CTGAGGCCACCCAGGGAGAATGG + Intergenic
1061665802 9:132160725-132160747 CTGAGGACAGACAGAGAGAGAGG - Intergenic
1062278518 9:135741749-135741771 CTGAGGCCACACAGGCAGGAAGG - Intronic
1062370423 9:136236007-136236029 CTTCGGACCCAGAGGGAGACTGG - Intronic
1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG + Intergenic
1185618424 X:1437473-1437495 GTGAGGACACAGGGGGAAGACGG - Intronic
1185704736 X:2258289-2258311 GTGAGGACACAGAGAGAAGATGG + Intronic
1185790209 X:2923600-2923622 CTGAGGACACAGGGAGAAGATGG - Intronic
1186367094 X:8906987-8907009 CTAAGGACACAGAGTGAGGTAGG + Intergenic
1186512292 X:10139058-10139080 CGCAGCCCACAGAGGGAGAAGGG - Intronic
1187144693 X:16626767-16626789 CAGAGGTCACAGAAGGGGAAGGG - Intronic
1187200839 X:17132349-17132371 CTGAAGGCAGAGAGGGAGAGGGG + Intronic
1187489770 X:19739989-19740011 CAGAAGACACAGAGATAGAAAGG + Intronic
1187729200 X:22235515-22235537 GTGAGGACACAGAGAGAAATTGG - Intronic
1188522439 X:31053746-31053768 CTGAGGAGAGAGAGGGAGGGAGG - Intergenic
1188932235 X:36125870-36125892 ATGATGACACTGAGGGAGGAAGG - Intronic
1189054127 X:37680692-37680714 CTGAGGAAGAAGAGGGAGAAGGG + Intronic
1189068166 X:37834083-37834105 CAGAGGACAGAGATGGTGAAGGG - Intronic
1189246803 X:39569489-39569511 ATGAGGACATAAAGGGTGAAGGG + Intergenic
1189985409 X:46549172-46549194 CTTGAGACACAGAGGGAAAAAGG - Intergenic
1190047684 X:47125833-47125855 GTGAGGACACAGTGAGAGGATGG - Intergenic
1190104563 X:47550152-47550174 CTGAGCACACAGCGAGAGAGCGG - Intergenic
1190341933 X:49303853-49303875 CTGTGGCCTCTGAGGGAGAAGGG + Intronic
1190344161 X:49322235-49322257 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190345256 X:49331780-49331802 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190346350 X:49341346-49341368 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190347601 X:49532375-49532397 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190348702 X:49541931-49541953 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190349802 X:49551487-49551509 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190350907 X:49561040-49561062 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190352008 X:49570598-49570620 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190353109 X:49580147-49580169 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190354210 X:49589694-49589716 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190355312 X:49599218-49599240 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190451496 X:50585708-50585730 ACGAGGTCACAGAGTGAGAAGGG + Intergenic
1190491886 X:50990624-50990646 CTGAGGGCAGAGAGGGAGGCAGG - Intergenic
1190496646 X:51033412-51033434 CTGAGGAGTCTGAGGGAGGATGG - Intergenic
1190501276 X:51081056-51081078 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1190509326 X:51160525-51160547 CTGAGGAGTCTGAGGGAGGATGG + Intergenic
1191151223 X:57222368-57222390 CTGTCGATATAGAGGGAGAAAGG - Intergenic
1192173692 X:68873046-68873068 CTGAGGCCCCAGAGGGAGAAAGG - Intergenic
1192179512 X:68907610-68907632 CTGAGGCCAGGAAGGGAGAAAGG + Intergenic
1192285153 X:69727464-69727486 GTGAGAACACAGCAGGAGAATGG - Intronic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1193396129 X:80985672-80985694 CTGAGGAGAGGGAGGGAGAAGGG + Intergenic
1194566201 X:95492464-95492486 CTCAGGAACCTGAGGGAGAAAGG - Intergenic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1197043310 X:121966655-121966677 CTGAAGAGACAGAGGTAGAAAGG + Intergenic
1197272843 X:124444711-124444733 CTGAGTACTCAGAGGTAGAATGG - Intronic
1198161882 X:134016176-134016198 CTGATGAAAAAGGGGGAGAAAGG + Intergenic
1198512812 X:137371322-137371344 GTGAGGACACAGAGAGAAAGTGG - Intergenic
1199681439 X:150227383-150227405 GTGAGAACAGAGAGAGAGAAAGG + Intergenic
1199693103 X:150324091-150324113 GTGAGGACACAGGGAGAAAATGG + Intergenic
1199714351 X:150495669-150495691 CTGGGGACACAGAGTCAGAGAGG + Intronic
1199828634 X:151525967-151525989 CTCAGGAGGCTGAGGGAGAATGG + Intergenic
1199971989 X:152868008-152868030 CTGAGGAATGAGTGGGAGAAAGG - Intronic
1200420221 Y:2957125-2957147 GTGAGAATCCAGAGGGAGAAGGG - Intronic
1201284103 Y:12364337-12364359 CTGAGGACACAGGGAGAAGATGG + Intergenic
1201471155 Y:14336290-14336312 CAGAGGACAAAGGAGGAGAAAGG - Intergenic