ID: 1060522677 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:124302642-124302664 |
| Sequence | TACCCCATGCTGCCCGGGCC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1060522672_1060522677 | 28 | Left | 1060522672 | 9:124302591-124302613 | CCTTCAGCAGCTTTTCTGAAGGT | 0: 1 1: 0 2: 2 3: 29 4: 233 |
||
| Right | 1060522677 | 9:124302642-124302664 | TACCCCATGCTGCCCGGGCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1060522677 | Original CRISPR | TACCCCATGCTGCCCGGGCC TGG | Intronic | ||
| No off target data available for this crispr | |||||