ID: 1060522677

View in Genome Browser
Species Human (GRCh38)
Location 9:124302642-124302664
Sequence TACCCCATGCTGCCCGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060522672_1060522677 28 Left 1060522672 9:124302591-124302613 CCTTCAGCAGCTTTTCTGAAGGT 0: 1
1: 0
2: 2
3: 29
4: 233
Right 1060522677 9:124302642-124302664 TACCCCATGCTGCCCGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060522677 Original CRISPR TACCCCATGCTGCCCGGGCC TGG Intronic
No off target data available for this crispr