ID: 1060524936

View in Genome Browser
Species Human (GRCh38)
Location 9:124315199-124315221
Sequence CCCAGGAAGCGGGTTTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 128}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060524936_1060524945 -3 Left 1060524936 9:124315199-124315221 CCCAGGGAAACCCGCTTCCTGGG 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1060524945 9:124315219-124315241 GGGCAGGCCTCACAGAGGGCAGG No data
1060524936_1060524948 16 Left 1060524936 9:124315199-124315221 CCCAGGGAAACCCGCTTCCTGGG 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1060524948 9:124315238-124315260 CAGGGCACCATCCCAGAATCTGG No data
1060524936_1060524949 20 Left 1060524936 9:124315199-124315221 CCCAGGGAAACCCGCTTCCTGGG 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1060524949 9:124315242-124315264 GCACCATCCCAGAATCTGGAAGG No data
1060524936_1060524946 -2 Left 1060524936 9:124315199-124315221 CCCAGGGAAACCCGCTTCCTGGG 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1060524946 9:124315220-124315242 GGCAGGCCTCACAGAGGGCAGGG No data
1060524936_1060524943 -7 Left 1060524936 9:124315199-124315221 CCCAGGGAAACCCGCTTCCTGGG 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1060524943 9:124315215-124315237 TCCTGGGCAGGCCTCACAGAGGG No data
1060524936_1060524942 -8 Left 1060524936 9:124315199-124315221 CCCAGGGAAACCCGCTTCCTGGG 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1060524942 9:124315214-124315236 TTCCTGGGCAGGCCTCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060524936 Original CRISPR CCCAGGAAGCGGGTTTCCCT GGG (reversed) Intronic
900314703 1:2050900-2050922 CCCCGGGACCGGGTTTCCCTGGG + Intronic
900469866 1:2848426-2848448 CCCAGAGAGGGGGTCTCCCTGGG + Intergenic
900739474 1:4322027-4322049 CCGAGGGAGGGGGTTTCACTTGG - Intergenic
902709146 1:18226878-18226900 CCCAGGAATGAGGTTCCCCTCGG + Intronic
902731618 1:18373637-18373659 CCCAGGAGCCGGGGTGCCCTGGG + Intronic
902873039 1:19325660-19325682 GGGAGGAAGCGGGTTTCCCATGG + Intronic
904014511 1:27409574-27409596 CCCAGGAAACGGCTTTCATTGGG - Intronic
906783786 1:48596376-48596398 CCCAGGAAGATGTTTTCCCCTGG + Intronic
908313142 1:62905724-62905746 CCAAGGAAGCACGTTTCCCTGGG + Intergenic
910889350 1:92001096-92001118 CCCAGGCAGCATCTTTCCCTTGG + Intronic
916726250 1:167526510-167526532 CCCAGGATTCAGATTTCCCTGGG + Intergenic
919847410 1:201650484-201650506 CCCAGGAAGCTCGGGTCCCTCGG - Intronic
919927369 1:202199286-202199308 TCCAGGAAGTGGGGTCCCCTGGG + Intronic
921397468 1:214683770-214683792 CCCAGGAAGCGGATGACCCTGGG + Intergenic
922732066 1:227953736-227953758 GCCAGGCAGGGGGTGTCCCTAGG + Intergenic
923067996 1:230537895-230537917 CACAGGAAATGTGTTTCCCTTGG - Intergenic
1062934185 10:1374000-1374022 CACTGGAAGCGGGTTTCACTAGG - Intronic
1067944328 10:50680831-50680853 CCCAGGCAGGGGACTTCCCTAGG - Intergenic
1070865828 10:79707702-79707724 CCCAGGCAGGGGACTTCCCTAGG - Intronic
1070879621 10:79845833-79845855 CCCAGGCAGGGGACTTCCCTAGG - Intronic
1071632727 10:87229923-87229945 CCCAGGCAGGGGACTTCCCTAGG - Intronic
1071646176 10:87362141-87362163 CCCAGGCAGGGGACTTCCCTAGG - Intronic
1075265838 10:120999131-120999153 CCCTGGCAGTGGGTTTCCCTTGG + Intergenic
1084746168 11:71171383-71171405 CCCAGGCAGCCGCTTCCCCTCGG - Intronic
1086373645 11:86178842-86178864 CCCAGGCAGCATGTTTCCCCTGG - Intergenic
1092918344 12:13208389-13208411 CCCAGACTGAGGGTTTCCCTGGG + Intronic
1096070538 12:48773276-48773298 CCCAGGACTAGGGTTTCCTTGGG + Intronic
1097704026 12:62849106-62849128 CACAGGAAGCTTGTTTCCCAAGG + Intronic
1103141660 12:118554026-118554048 CCCAGGAAGCAGCCTGCCCTGGG - Intergenic
1104068858 12:125327753-125327775 CCCAGGCAGCTGCTGTCCCTTGG - Intronic
1115419660 14:33180002-33180024 CCCAGGAAGATGTTTGCCCTCGG + Intronic
1118599479 14:67461875-67461897 CCAAGGAACAGGCTTTCCCTTGG + Intronic
1119322367 14:73739553-73739575 TCCAGGATGCGGGCTCCCCTTGG + Exonic
1120400259 14:84022529-84022551 CCCAGGAATGGGGTTTCCTGTGG + Intergenic
1125593769 15:40871960-40871982 GCCTGGAAACGGGTTTCCCCAGG - Intergenic
1127396294 15:58546255-58546277 CCCCGGGAGAGGGTTTGCCTGGG - Intronic
1128084125 15:64874192-64874214 CCCATGAAGCCTGTGTCCCTAGG + Intronic
1128724739 15:69980049-69980071 TCCAGGACGCAGGTTTCCCCTGG + Intergenic
1129068975 15:72935634-72935656 CCCTGGAAGGGGATTTCCCCTGG + Intergenic
1129129793 15:73483579-73483601 TCCAGGAAGCTGGTGTCCTTAGG + Intronic
1131693658 15:94853991-94854013 CCCAGGCTGCAGGGTTCCCTAGG + Intergenic
1132129849 15:99265692-99265714 CCCAGGAAGCGGGTGTTTCATGG + Intronic
1132553851 16:564294-564316 CCCAGGAGGAGGCTGTCCCTGGG + Exonic
1132840554 16:1976682-1976704 CCCAGGATGCGGGTTGGCCTGGG - Intronic
1136367689 16:29816446-29816468 CCCAGGGATCGGGCTCCCCTGGG - Exonic
1140227660 16:73091411-73091433 CCAAGAAAGAGGGATTCCCTGGG - Intergenic
1140358554 16:74325819-74325841 CCCATGAAGTGGGTTTGGCTTGG + Intergenic
1142298896 16:89244826-89244848 CCGAGGACGTGGGTATCCCTGGG - Intergenic
1143090256 17:4445823-4445845 CCCAGGAAAAGGGCTCCCCTGGG + Intronic
1143368096 17:6421483-6421505 CCGAGGAAGGGGGTGTCCCTCGG + Intronic
1147388645 17:40096221-40096243 CCCATCAAGGGGGTTTCCCTAGG + Intronic
1147425303 17:40343299-40343321 CACAGGAAGGGGCTCTCCCTCGG - Intronic
1147918092 17:43900519-43900541 CCCAGGCAGCGGGGTCTCCTTGG - Intronic
1148165910 17:45483856-45483878 CTCAGGAATCGGGTTTTCCTAGG - Intronic
1149218487 17:54387536-54387558 CCAAGGAAGTGGTTTTCCGTGGG + Intergenic
1150397134 17:64830581-64830603 CTTAGGAATCGGGTTTTCCTAGG - Intergenic
1150441495 17:65195212-65195234 GCCAGGAAGAGGGTTGTCCTAGG + Intronic
1150885664 17:69082687-69082709 CCCAGGAAGCTGTGTCCCCTGGG - Intronic
1152196444 17:78921218-78921240 CCCAGGAACCAGGTCACCCTTGG + Intronic
1152649019 17:81483424-81483446 CCCAGGCAGGGGCTGTCCCTCGG - Intergenic
1154494506 18:14945598-14945620 CACAGGAAGCTGAATTCCCTGGG + Intergenic
1157425438 18:47580561-47580583 GCCAGGAAGGGGGCCTCCCTGGG + Intergenic
1157480520 18:48050697-48050719 CCCAGGAAGCAGGCACCCCTGGG + Intronic
1157552642 18:48592173-48592195 CCCAGGAAGCTGGGGTCTCTCGG - Intronic
1159401219 18:67937568-67937590 CCAATGAAGCAGGTATCCCTGGG + Intergenic
1161035582 19:2082652-2082674 CCCGGGAAGCGTGTGTCACTAGG - Intronic
1161120349 19:2522234-2522256 CCTACGAAGCAGGTTTCTCTAGG - Intronic
1161282475 19:3453563-3453585 ACCAGCAAGCGGGTGTCCCCAGG + Intronic
1161374315 19:3931331-3931353 CCCAGGAGCCGGGCTTTCCTGGG + Intergenic
1161772161 19:6236735-6236757 CCCAGGAGGCTGGTTTCCAGGGG - Intronic
1164674777 19:30094009-30094031 CCCAGGAAGCGTGTGGGCCTGGG - Intergenic
1165340984 19:35212038-35212060 CCCAGGCAGAGGGTTTTGCTAGG + Intergenic
1166874927 19:45891235-45891257 CCCAGGAAGGGGGCTGCCCACGG - Exonic
1167018370 19:46856658-46856680 CACAGGAAGCGGGCTTCCCTGGG - Intergenic
1167328165 19:48837514-48837536 ACCGGGAAGAGGGTCTCCCTGGG + Exonic
1168213659 19:54909612-54909634 CCCAGGAAGTGGACGTCCCTTGG - Intronic
925843892 2:8018695-8018717 CCCAGGAAGAGGGTTGGACTTGG + Intergenic
926571541 2:14535176-14535198 CCCAGGGAGCAGGAGTCCCTGGG + Intergenic
928749955 2:34459402-34459424 CACAGGAATGGGGTTTCCCAAGG + Intergenic
929501641 2:42494902-42494924 CCCAGAAAGCGGGTTCCACTTGG + Exonic
932575155 2:72958759-72958781 CCCAGGCTGCAGGTTTCCCAGGG + Intronic
934746678 2:96763916-96763938 CCCAGGAATCAGGTTTTCCCAGG + Intronic
942948473 2:181696111-181696133 ACCAGGAACCAGGTTTTCCTAGG - Intergenic
1171157249 20:22887391-22887413 CCCACGAAGCTGGTTTCCATAGG - Intergenic
1172806140 20:37613212-37613234 CCCAGGAAGCTGTTTGTCCTAGG + Intergenic
1174067841 20:47878578-47878600 CCCAGGAGGCGGGCTTCACGAGG - Intergenic
1177559347 21:22730111-22730133 CCCAGGAAGCTGCTTCCCCGTGG + Intergenic
1178894457 21:36547660-36547682 TCCAGGAAGCAGGTCTCCCAGGG + Intronic
1179356776 21:40667143-40667165 CACAGGAAGTGGCTTTCACTTGG - Intronic
1180041186 21:45281079-45281101 CCCCGGAAGAGACTTTCCCTGGG + Intronic
1180066466 21:45414988-45415010 ACCAGGAAGTGGGTTCCCCCTGG + Intronic
1180100102 21:45579872-45579894 CCCGGGATGCGGGTGGCCCTGGG + Intergenic
1180116326 21:45707921-45707943 CCCAGGAAGCTGGTCTTCCCAGG + Intronic
1181977806 22:26743631-26743653 CCCATTAAGCGTGTTTACCTTGG + Intergenic
1182175152 22:28278163-28278185 CTCAGGAAGCCTGTTTCTCTGGG + Intronic
1182558357 22:31140998-31141020 CCTAGGAAGCGGGGAGCCCTGGG - Intergenic
1183932008 22:41240725-41240747 TCCAGGAAGGGGGTCTCCCAAGG - Intronic
1184183618 22:42848778-42848800 ACCAGGAGGTGGGTTTCACTGGG - Intronic
1184709320 22:46239201-46239223 TCCAGGAAGGCTGTTTCCCTGGG - Exonic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
1184789360 22:46689897-46689919 CCCAGGGTGGGGGGTTCCCTGGG - Intronic
950533033 3:13564015-13564037 CCCAGCAACAGGGCTTCCCTGGG - Intronic
951321231 3:21248574-21248596 CCCTGGAGGCGTGATTCCCTTGG - Intergenic
954082783 3:48222245-48222267 CCCTGGCCTCGGGTTTCCCTGGG - Intergenic
955761216 3:62285157-62285179 CCCAGGCATTGGGTTTCCCCCGG - Intronic
956716534 3:72085099-72085121 CCCAGGAAGGGGATATCACTTGG - Intergenic
959447100 3:106453969-106453991 CCCAGGAAGCAGGTGTGACTTGG + Intergenic
961211538 3:125129538-125129560 CCCAGGAAGCTGCCTGCCCTTGG + Intronic
963412478 3:144948073-144948095 CCCAGGAAGCTGTTTTTCCCTGG + Intergenic
964986821 3:162752536-162752558 CCCAGGAAGGAGGTTTACTTTGG - Intergenic
966762078 3:183427789-183427811 CCCAGGAAGCGCGCTGCCCCGGG + Intronic
968725728 4:2247045-2247067 CCCAGGGAGCGGGCTGTCCTCGG + Intergenic
968812605 4:2806718-2806740 ACCTGGAAGAGGGTTGCCCTAGG - Intronic
973835237 4:54803011-54803033 TCAAGGAAGAGGCTTTCCCTTGG - Intergenic
981646373 4:147003553-147003575 TCCAGGAAGTGGTCTTCCCTGGG + Intergenic
986050308 5:4083980-4084002 CCCAGGAAGTGTGTTCCCTTAGG + Intergenic
994543389 5:101129596-101129618 ACCAGGAAGCATGTTTCCTTAGG - Intergenic
998176324 5:139904266-139904288 CCCAGAAACCCGGTTTCCCTGGG - Intronic
998804383 5:145904362-145904384 CCCTGGAAATGGTTTTCCCTAGG + Intergenic
1001080369 5:168663157-168663179 CCCAGGAAGCCAGTGACCCTCGG + Intronic
1001399416 5:171437709-171437731 CCCAGGTGGTGGTTTTCCCTCGG + Intronic
1002093122 5:176816418-176816440 CCCAGGAAGGGGGTGGGCCTTGG - Intronic
1016813824 6:148285455-148285477 CCCAGAAAGTGGTGTTCCCTGGG - Intronic
1018725691 6:166611925-166611947 CCCAGGATGCAGATCTCCCTGGG + Intronic
1025764117 7:64426208-64426230 CTCAGAAAGCTGGTTTCCCTAGG - Intergenic
1026631686 7:72043330-72043352 CCCAGGAAGCCCATTTCCCAGGG + Intronic
1026907146 7:74069055-74069077 CCCAGGTAGGGGGTTCCCCGAGG - Intronic
1026932155 7:74229184-74229206 ACCAGGAGCCGGGTTACCCTTGG - Exonic
1029499983 7:100923002-100923024 CTCAGGAAGAGAGTCTCCCTTGG + Intergenic
1033187243 7:139239084-139239106 CCTAGGAAGTGGGATTCCATGGG - Intronic
1035255978 7:157627779-157627801 CTCAGGAAGTGGGTTTCCCAAGG + Intronic
1036204373 8:6794376-6794398 CCCAGGGACCGGGGTTCCCAAGG + Intergenic
1040545570 8:48396205-48396227 CCCAGGAAGCAGGTTCCCTATGG + Intergenic
1046074917 8:109303108-109303130 CCCAGGCTGCGGGCTTTCCTTGG - Intronic
1046512097 8:115214523-115214545 CCCAGGCAGCGGGCATTCCTTGG - Intergenic
1047399645 8:124535134-124535156 CTCAGGATGGGGGTTTGCCTAGG - Intronic
1051818372 9:21135635-21135657 CCAAGAAAAGGGGTTTCCCTTGG - Intergenic
1052597205 9:30575404-30575426 CCCAGAACTCGGGATTCCCTGGG + Intergenic
1057831032 9:98407266-98407288 CCCAGGAAGCATTTTTCCTTAGG + Intronic
1058358328 9:104108849-104108871 CCCAGAAAGCAGCTTGCCCTGGG + Intronic
1060524936 9:124315199-124315221 CCCAGGAAGCGGGTTTCCCTGGG - Intronic
1185456304 X:312558-312580 CCCAGGAGACGGGTTTCCTGTGG - Intronic
1189286191 X:39854104-39854126 CCCAGGAACCAGGGTTCCTTGGG - Intergenic
1197747411 X:129940903-129940925 GTCAGGAAGTGGGTTTCACTGGG + Intergenic