ID: 1060528127

View in Genome Browser
Species Human (GRCh38)
Location 9:124331998-124332020
Sequence GACCTGTGACTGCCACCGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060528127_1060528134 3 Left 1060528127 9:124331998-124332020 CCCCTCGGTGGCAGTCACAGGTC 0: 1
1: 0
2: 2
3: 12
4: 118
Right 1060528134 9:124332024-124332046 CACCTTCCTGGCATTTTCAGGGG No data
1060528127_1060528133 2 Left 1060528127 9:124331998-124332020 CCCCTCGGTGGCAGTCACAGGTC 0: 1
1: 0
2: 2
3: 12
4: 118
Right 1060528133 9:124332023-124332045 CCACCTTCCTGGCATTTTCAGGG No data
1060528127_1060528137 17 Left 1060528127 9:124331998-124332020 CCCCTCGGTGGCAGTCACAGGTC 0: 1
1: 0
2: 2
3: 12
4: 118
Right 1060528137 9:124332038-124332060 TTTCAGGGGCACAGACTGTTAGG No data
1060528127_1060528130 -9 Left 1060528127 9:124331998-124332020 CCCCTCGGTGGCAGTCACAGGTC 0: 1
1: 0
2: 2
3: 12
4: 118
Right 1060528130 9:124332012-124332034 TCACAGGTCTGCCACCTTCCTGG No data
1060528127_1060528131 1 Left 1060528127 9:124331998-124332020 CCCCTCGGTGGCAGTCACAGGTC 0: 1
1: 0
2: 2
3: 12
4: 118
Right 1060528131 9:124332022-124332044 GCCACCTTCCTGGCATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060528127 Original CRISPR GACCTGTGACTGCCACCGAG GGG (reversed) Intronic
900394132 1:2446223-2446245 GGCCTGTGACAGCCCCAGAGTGG - Intronic
900424597 1:2570392-2570414 GTCCTGTGACAGCCGCCCAGGGG - Intergenic
901807857 1:11749339-11749361 GGCCTGTGACTGCCACCAGCTGG + Intronic
902121027 1:14165870-14165892 GTCCTGTGACTGCCACACAAGGG + Intergenic
903056075 1:20637084-20637106 GAGCTGTGCCTGGCACCCAGGGG + Intronic
903270156 1:22183112-22183134 GACCTGTGACGGCTGCCCAGGGG + Intergenic
904321037 1:29698005-29698027 GACCTGTGAGAGCCACGGAAGGG - Intergenic
907117882 1:51985757-51985779 TAGCTGTGACTGCCACAGATAGG + Intronic
907158241 1:52353645-52353667 GACCTGTGAGGACCACAGAGAGG + Exonic
913362151 1:117993271-117993293 GGCCTGTGACAGCCACTTAGGGG + Intronic
915555513 1:156658729-156658751 GACCTGTGAGTGCCAGGAAGAGG + Exonic
916535555 1:165699755-165699777 GACCTGTGAGTGCCTCTGGGTGG - Intergenic
917880438 1:179330267-179330289 GTCCTGTGACCCCCACCCAGAGG - Intronic
920191540 1:204196982-204197004 GCCCTGTGACTGGCACAGGGTGG + Intergenic
920314732 1:205069492-205069514 GTCCTGAGGGTGCCACCGAGGGG - Exonic
924931870 1:248739480-248739502 GACCTGTGACTCCCACTTACTGG + Exonic
1063282909 10:4650437-4650459 GACCTGGGTTTGGCACCGAGTGG - Intergenic
1067008731 10:42690746-42690768 AACCTGTCACTGCCACCCAGTGG - Intergenic
1067036973 10:42927984-42928006 GACCTGTGCCTGACAAGGAGGGG - Intergenic
1068649697 10:59508484-59508506 CACCTGTGGCTGCAACCCAGAGG - Intergenic
1068771457 10:60826199-60826221 GCCCTGTGGCTCCCACCCAGAGG + Intergenic
1075537337 10:123282548-123282570 GAACTGTGACACTCACCGAGAGG - Intergenic
1076312970 10:129521364-129521386 GGCCAGTGACTCCCACCAAGAGG - Intronic
1076865746 10:133165440-133165462 GACCTGTGAGTGACAGCCAGAGG + Intronic
1077044109 11:536904-536926 GAGCTCTGACTGCGACCGCGCGG - Intronic
1078143436 11:8707669-8707691 CACCTGTGACTGTGAGCGAGCGG - Intronic
1084522190 11:69670396-69670418 CAGCTTTGACTGCCACCTAGTGG + Intronic
1085736679 11:79045236-79045258 TACCTGTGCCTCCCACAGAGAGG - Intronic
1091754924 12:3045087-3045109 GACTTGGGACTGCCACTGGGAGG + Intergenic
1092275610 12:7058802-7058824 GTCCTGTGACCCCCACCCAGAGG + Intronic
1092444770 12:8544412-8544434 AGCCTGTTACTGCCACCTAGTGG - Intergenic
1094169887 12:27480369-27480391 CACCTGTGCATGCCACCCAGGGG - Intronic
1099488633 12:83259475-83259497 CACTTGTGACTTCCACCCAGTGG + Intergenic
1101902810 12:108803684-108803706 TTGCTGTGACTGCCACCTAGTGG + Intronic
1107422164 13:40257559-40257581 TACCTGTGAATGCCACAGATAGG + Intergenic
1108820026 13:54337005-54337027 CACCTGTGACTACCACTAAGTGG - Intergenic
1115905844 14:38202175-38202197 GAACAGTGCCTGCCACCCAGTGG + Intergenic
1119574741 14:75709397-75709419 ATGCTGTGACTGCCACCTAGAGG - Intronic
1121517358 14:94561448-94561470 GAGCTGAGACAGCCACCCAGGGG + Exonic
1122480887 14:102046582-102046604 GGCCTGTGACTGCCACCATGTGG - Intronic
1126676463 15:51162940-51162962 GACATGTGACAGCCACTGAGGGG - Intergenic
1128664761 15:69530063-69530085 GACCTGGCACTGCCACTCAGTGG - Intergenic
1128694602 15:69751350-69751372 GACCTGAGACAGCCACCGTGAGG + Intergenic
1131036490 15:89225925-89225947 GACCTGTCACTGCCACCAGCTGG + Intergenic
1132602585 16:780229-780251 GACCTGTGACCCCCACCATGGGG + Intronic
1133709305 16:8385723-8385745 GACCTGTGATGGACAGCGAGTGG - Intergenic
1137697739 16:50473601-50473623 GAGCTGTGACTGCTACCTTGTGG - Intergenic
1142376860 16:89711050-89711072 CACCTGTGGATGCCACGGAGAGG - Intronic
1147782981 17:42957012-42957034 GAGCTGTGATTGCCACCAAATGG - Intronic
1150898860 17:69246965-69246987 GATCAATGACTGCCACCTAGTGG + Exonic
1151309376 17:73284037-73284059 GTCCTGTAACTGTCCCCGAGGGG - Exonic
1151491149 17:74432784-74432806 GACCGCGGACTCCCACCGAGAGG - Intronic
1151719986 17:75849527-75849549 AACCTCTGACTGCCGCCGTGGGG - Intronic
1152113173 17:78368564-78368586 CCCCTGTGTATGCCACCGAGTGG - Intergenic
1153536574 18:6108283-6108305 GACTTGTGCCTGGCACTGAGGGG + Intronic
1153666592 18:7371974-7371996 GACCTGTGACTGTCACCCTAGGG - Intergenic
1158324941 18:56303570-56303592 CAACAGTGTCTGCCACCGAGGGG - Intergenic
1160862753 19:1244647-1244669 GAGCTGTGGCTGCCACCCATGGG + Exonic
1162967868 19:14164499-14164521 GACCTGGGACTGCCCCCCTGAGG - Intronic
1164425106 19:28134306-28134328 GACCTGTCACTGCCTTCCAGAGG + Intergenic
1166684042 19:44784546-44784568 GACCTTTGACTGCCACCTGCTGG - Intronic
1166738880 19:45102365-45102387 GAGCTGGGACTGGCACCCAGGGG - Intronic
1168057367 19:53870611-53870633 GTCCTGCGACTGCCACGAAGAGG + Intronic
925636523 2:5946459-5946481 GACCAGTGACTGCCACAAAAGGG - Intergenic
926251530 2:11157779-11157801 GACCTGCCTCTGCCACCCAGGGG + Intronic
933301608 2:80547050-80547072 GACCTCTGACTGCAACAGTGTGG + Intronic
934922944 2:98360247-98360269 CACCTGTGGCTGGCACCTAGTGG + Intronic
936979983 2:118255401-118255423 CATCTGTGACTGGCACCCAGAGG + Intergenic
938951173 2:136256222-136256244 GGCCTGTCACTGCCACAGCGTGG + Intergenic
940722780 2:157299747-157299769 GGTATGTGACTGCCACTGAGAGG + Intronic
946388191 2:219398868-219398890 GGCCTGTGCCTGCCACCTGGAGG - Intronic
946929377 2:224656996-224657018 GAACTGTAACACCCACCGAGAGG + Intergenic
947137245 2:226987611-226987633 GACCTCTGACTCCCACACAGAGG - Intronic
948796842 2:240408237-240408259 GATCTGTGACTGGCCCAGAGAGG - Intergenic
949049218 2:241888339-241888361 GAGCTGTGGCTGCCTCTGAGAGG - Intergenic
1170110387 20:12798331-12798353 TACCTGTGAATGCTACCTAGAGG - Intergenic
1173877118 20:46380348-46380370 CACCTGTGACTACTATCGAGAGG + Intronic
1174713100 20:52728115-52728137 CCCCTGTGAGTGCCACTGAGAGG - Intergenic
1179179074 21:39030219-39030241 GACCACTGGCTGCCACTGAGTGG - Intergenic
1180140666 21:45891900-45891922 GCCCTGTGCCTGTCACCCAGTGG + Intronic
1181306867 22:21921933-21921955 GAGCTGCGACTGCCACGTAGTGG - Exonic
1182102864 22:27670155-27670177 TACCTGTGCCAGGCACCGAGGGG + Intergenic
1182853185 22:33494026-33494048 GACCTGTGTTAGCCACGGAGTGG - Intronic
1184719327 22:46300727-46300749 GCTCTGTGACTGGCTCCGAGGGG - Intronic
950028210 3:9834917-9834939 GACCTGTGACTCACACCCAGTGG + Exonic
952495868 3:33915234-33915256 GCCCTGTGGCTGGCACTGAGTGG - Intergenic
953888986 3:46736539-46736561 GTCCTGTGACTGCCACAGCCAGG - Intronic
956458153 3:69444037-69444059 GACCTGTGGCCCCCACCCAGAGG + Intronic
960986881 3:123286622-123286644 GTCCTGTGTCTGACACCGAGAGG - Intronic
960989645 3:123302062-123302084 GGCCTGTGACTGCAGCTGAGGGG - Intronic
961820477 3:129573236-129573258 GATCTGTGACTGGCCCAGAGGGG - Intronic
963923308 3:150925935-150925957 GGCCTTTGATTCCCACCGAGTGG + Intronic
968073644 3:195803794-195803816 GCTCTGGGACTGCCACCGAGTGG + Intronic
969037558 4:4267008-4267030 GGCCTGTGACTGGAAGCGAGAGG - Intergenic
978441066 4:108733909-108733931 GAGCTGGGACTGGCACCCAGAGG - Intergenic
978913336 4:114092759-114092781 GTCCTGTTTCAGCCACCGAGTGG + Intergenic
979167963 4:117560511-117560533 AAACTGTGACTGCCACCAAGTGG + Intergenic
979654479 4:123176248-123176270 GATCTGTTACTGTCACAGAGTGG + Intronic
985716729 5:1467178-1467200 CACCTGTGGCTGCCACTGGGAGG + Intronic
986746909 5:10753152-10753174 GAGCGGTGCCTGCCACAGAGTGG - Intronic
988099649 5:26660163-26660185 GAGCTGTAACACCCACCGAGTGG - Intergenic
988781197 5:34523308-34523330 GACATGTGATTGCCACCTAGCGG - Intergenic
992367519 5:76108137-76108159 GACCTGTGATTGACAGAGAGTGG + Intronic
993415952 5:87631250-87631272 GACCTGTGAGGGCCACAGATGGG + Intergenic
993489154 5:88524928-88524950 GAGCTGTAAATGCCAACGAGAGG + Intergenic
995589324 5:113682856-113682878 GCCCTGTGGCTGCCAGCAAGGGG + Intergenic
996756147 5:126937221-126937243 CATCTGTGACTGCCCCCAAGTGG - Intronic
1000608938 5:163354468-163354490 GTCTTGTGACTCCCACCCAGAGG - Intergenic
1001732906 5:173973333-173973355 GAGCTGTGACTGCCACCTGGTGG + Intergenic
1005622538 6:27633270-27633292 CAGCTGTGTCTGCCACCCAGAGG + Intergenic
1006853192 6:37114214-37114236 GGCCTCTGTTTGCCACCGAGGGG - Intergenic
1019406331 7:886042-886064 GACATGTACCTGCCACAGAGAGG - Exonic
1019853663 7:3583769-3583791 GTCCTGTGAATGCCACCGAGAGG + Intronic
1021421022 7:20444687-20444709 GTCCTGTGACCACCACCCAGAGG + Intergenic
1024041517 7:45559723-45559745 GTCCTGTGACCCCCACCCAGAGG + Intergenic
1034415661 7:150963145-150963167 GGGCTGTGCCTGCCACGGAGTGG - Intronic
1035720259 8:1785984-1786006 GTCCTGTGACTTCCAGGGAGGGG - Exonic
1036651952 8:10649903-10649925 GACCTGTGACAGCAAGCAAGAGG - Intronic
1037877407 8:22554762-22554784 GGCCTGGGACTGTCACCGAGGGG + Intronic
1038085759 8:24194654-24194676 GGCCTGTGACTGCCACCCAGCGG + Intergenic
1041788132 8:61658702-61658724 TACCTGTGACTGGCAGGGAGGGG - Intronic
1042958382 8:74276399-74276421 GTCCTGTTACTGCCACATAGAGG - Intronic
1059176395 9:112173498-112173520 GATCTGTGTCTGCCAACGTGAGG - Intronic
1059855684 9:118394898-118394920 GACTTGTGAATACCACCCAGAGG - Intergenic
1060477893 9:123999540-123999562 GGCCGGTGACAGCCACGGAGCGG + Intergenic
1060528127 9:124331998-124332020 GACCTGTGACTGCCACCGAGGGG - Intronic
1061922043 9:133787769-133787791 GGCCTGTGGCTGCCAGCGGGTGG - Intronic
1190535307 X:51420823-51420845 TACTTGAGACTGCCACCTAGTGG + Intergenic
1194409988 X:93545464-93545486 GAACTGTGACTGCCACATAGAGG - Intergenic
1194424531 X:93720168-93720190 GACATGTGAATGCCAGAGAGTGG - Intergenic
1195140972 X:101959395-101959417 GTCCTGTGGCTCCCACCCAGAGG - Intergenic
1195994241 X:110715655-110715677 GACATGTCACTGCAACCTAGGGG - Intronic
1197831305 X:130646182-130646204 GATCTTTGACTGCCATGGAGAGG - Intronic