ID: 1060531010

View in Genome Browser
Species Human (GRCh38)
Location 9:124346992-124347014
Sequence CTCTGCACTCGCTGTGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 231}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060531010_1060531018 4 Left 1060531010 9:124346992-124347014 CCAGAGACACAGCGAGTGCAGAG 0: 1
1: 0
2: 0
3: 32
4: 231
Right 1060531018 9:124347019-124347041 GGTCGGGACAGAGCTAGGGCTGG No data
1060531010_1060531019 10 Left 1060531010 9:124346992-124347014 CCAGAGACACAGCGAGTGCAGAG 0: 1
1: 0
2: 0
3: 32
4: 231
Right 1060531019 9:124347025-124347047 GACAGAGCTAGGGCTGGCTGTGG No data
1060531010_1060531016 -1 Left 1060531010 9:124346992-124347014 CCAGAGACACAGCGAGTGCAGAG 0: 1
1: 0
2: 0
3: 32
4: 231
Right 1060531016 9:124347014-124347036 GCTGGGGTCGGGACAGAGCTAGG No data
1060531010_1060531020 17 Left 1060531010 9:124346992-124347014 CCAGAGACACAGCGAGTGCAGAG 0: 1
1: 0
2: 0
3: 32
4: 231
Right 1060531020 9:124347032-124347054 CTAGGGCTGGCTGTGGAGCCAGG No data
1060531010_1060531017 0 Left 1060531010 9:124346992-124347014 CCAGAGACACAGCGAGTGCAGAG 0: 1
1: 0
2: 0
3: 32
4: 231
Right 1060531017 9:124347015-124347037 CTGGGGTCGGGACAGAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060531010 Original CRISPR CTCTGCACTCGCTGTGTCTC TGG (reversed) Intronic
900773729 1:4565852-4565874 CTCCGCCCTCGCTGTGGCTCTGG + Intergenic
900903984 1:5537665-5537687 CTCTTCAGTTGCTTTGTCTCAGG - Intergenic
901768698 1:11519705-11519727 CTCTGCCCTGGCAGTGTCACTGG + Exonic
902511919 1:16971363-16971385 CTCTGCACTGGCCGTGTCCCAGG + Intronic
903705763 1:25284631-25284653 CACTGCTCCAGCTGTGTCTCCGG - Exonic
903721475 1:25408789-25408811 CACTGCTCCAGCTGTGTCTCCGG + Exonic
904494687 1:30879932-30879954 CTGTGCATGTGCTGTGTCTCTGG - Intronic
904797775 1:33070315-33070337 CTCTGCACTTGCTGTTCCTCTGG - Intronic
904967325 1:34385544-34385566 CTCTGTGCTCCTTGTGTCTCTGG - Intergenic
907325276 1:53633977-53633999 CTCTGCACTCACAGTGGATCTGG - Intronic
908537436 1:65091314-65091336 TTCTGCCCTCCCTGTCTCTCAGG + Intergenic
908658615 1:66414417-66414439 GTCTGCACTGGCTTTGTATCAGG + Intergenic
909320849 1:74284038-74284060 CTCTGAGCTCACTATGTCTCAGG + Intronic
910873381 1:91855068-91855090 CTCTGAACTCTTTGTGTCTGTGG - Intronic
911042386 1:93600898-93600920 CTGGGCACTCGCTGTGTGCCAGG - Intronic
911102931 1:94108060-94108082 CTCTCCACTTGCTCTGCCTCGGG + Intronic
912374372 1:109198430-109198452 CTGTGCACTCCCTGTGTGCCAGG + Intronic
914196769 1:145451832-145451854 CTCTCCACGCTCTCTGTCTCTGG - Intergenic
917480174 1:175404958-175404980 CTCTAGACTTGCTGTGTCTCAGG + Intronic
918046588 1:180945269-180945291 TTTTGCCCTCACTGTGTCTCTGG + Intronic
918630613 1:186713482-186713504 CACTGCAATCTCTGTCTCTCAGG + Intergenic
919578682 1:199343386-199343408 CAATGCACTCCCTGTGTCTTAGG + Intergenic
920766073 1:208835141-208835163 CTCTGAGCTCGCTGTGTGTGTGG - Intergenic
922357870 1:224794029-224794051 CTTTGCTCTCACTGTGTCTTTGG + Intergenic
922994676 1:229946104-229946126 CTCAGCAGTCACTGAGTCTCTGG - Intergenic
923741682 1:236660278-236660300 CTCTGCACTCGCAGGTTCTTTGG + Intergenic
924710232 1:246525037-246525059 ATCTGGACCCCCTGTGTCTCAGG - Intergenic
1062978624 10:1703370-1703392 CTTTGCACCTGCTGTGCCTCGGG - Intronic
1063844438 10:10110450-10110472 GTCTGCACTAGCAGTGCCTCAGG - Intergenic
1065896834 10:30170415-30170437 CTAAGCACTTGCTGTGTTTCAGG + Intergenic
1066323374 10:34327958-34327980 CTCTGGACTTGCTGTCTCTGTGG - Intronic
1066339077 10:34511848-34511870 GACTGCACTCGCTGTGGCTCGGG - Intronic
1067046077 10:42985926-42985948 CCCTGCACTCCCAGTTTCTCAGG - Intergenic
1069571543 10:69497369-69497391 CTCTGCACTCTCTCTGTTCCAGG + Intronic
1070645225 10:78197072-78197094 CTGTGCGCTTGCTGTGACTCAGG - Intergenic
1071336729 10:84606534-84606556 CTCTGCACGGCCTTTGTCTCTGG - Intergenic
1074112086 10:110429859-110429881 CTCTGCACTCGCTGAGTGCTTGG + Intergenic
1076652072 10:131996825-131996847 CTCTGCCCTCTCTGTGTGCCAGG - Intergenic
1077219535 11:1409609-1409631 CTCAGCAGTGGCTCTGTCTCTGG - Intronic
1078509969 11:11977688-11977710 CTGTGGACTCGGTGTGTCTGGGG - Intronic
1083203499 11:61133705-61133727 CTCTGGGCTCTCTGTGTCCCAGG - Intronic
1083487767 11:62994410-62994432 CCCTGCACTCTCTGGGGCTCAGG - Intronic
1083796896 11:65022033-65022055 CTGTGCCCTGGCTGTCTCTCTGG + Exonic
1084733573 11:71089945-71089967 CCCTGCCCTCGCTTTGTCCCTGG - Intronic
1086150687 11:83607020-83607042 CTCTGAGCCCGCTGTGTCTCAGG - Intronic
1087693269 11:101346740-101346762 CTCTGCATTCCCAGTGTCTAAGG + Intergenic
1089147128 11:116337254-116337276 CTCTGGACTAGCTGATTCTCTGG + Intergenic
1089689979 11:120181104-120181126 CTCTGCTCTTGATGTGTCTGGGG + Intronic
1090939370 11:131373852-131373874 CTCTGCCCTGTCTGTGTCTCAGG - Intronic
1091248234 11:134118541-134118563 CTCTGTCCTCTCTTTGTCTCTGG + Intronic
1091612049 12:2019088-2019110 CTCTGAACTCGGTGAGTCTATGG + Intronic
1091664638 12:2410371-2410393 CTCTGGAATCACTGTGGCTCTGG + Intronic
1091716626 12:2782042-2782064 CTCTGGAGTCGCAGTGTCTTGGG - Intergenic
1093266727 12:17012501-17012523 CACTGCTCTTGCTGTATCTCAGG + Intergenic
1095293038 12:40498222-40498244 CTCTGGACTTTCTGTGTTTCAGG + Intronic
1095895200 12:47273355-47273377 CTCTTATCTTGCTGTGTCTCAGG - Intergenic
1096655721 12:53090317-53090339 CCCTGCTCTCGCTGAGACTCAGG - Intergenic
1096670799 12:53197256-53197278 CTCTCCAGACGCTGGGTCTCAGG + Intronic
1098620255 12:72588357-72588379 CTTTGCACTTGCTGTTCCTCTGG - Intronic
1098858207 12:75678067-75678089 CACTGCAATCTCTGTCTCTCGGG - Intergenic
1101749918 12:107575075-107575097 TCCTTCACTCTCTGTGTCTCTGG + Intronic
1101883480 12:108641764-108641786 CTCTCCACTGGGTGTCTCTCAGG - Intergenic
1103159270 12:118714068-118714090 CTGAGCACTCGCTGTGTGCCAGG - Intergenic
1103899439 12:124295612-124295634 CTCTGGCCTCGCTGGGTCCCGGG - Intronic
1104003017 12:124872502-124872524 CTGAGCACTCGCTATGTATCAGG + Intronic
1104069573 12:125332521-125332543 CTCTGCACTTTCTGCGTCACGGG + Intronic
1104429287 12:128703838-128703860 CTGGGCACTCGCTGTGGGTCAGG - Intronic
1104445511 12:128829854-128829876 CTCTGCACTGGGTGAGGCTCAGG - Intergenic
1104947763 12:132424302-132424324 CTCTGCACTCCATTTTTCTCAGG - Intergenic
1106107707 13:26748319-26748341 CTCTGCACTCAATTTGTTTCAGG - Intergenic
1107412096 13:40167286-40167308 CTCTGCATTCTCTGTGGCCCAGG - Intergenic
1107427694 13:40310205-40310227 CTCTGCACTTCCTTTGGCTCAGG - Intergenic
1107533518 13:41306830-41306852 ATCTGAACTCACTGTTTCTCAGG - Intergenic
1108240304 13:48457391-48457413 CTCTGCTCTGGCTGAGACTCGGG + Intronic
1109745833 13:66622144-66622166 CACTGCACTCGATTTGTCACCGG + Intronic
1111006659 13:82258155-82258177 CTCTGCGCTCGCTTTCTCGCCGG + Intergenic
1113825679 13:113251434-113251456 CTCACCATTCCCTGTGTCTCTGG - Intronic
1113989203 13:114346312-114346334 CTCTGGAGTCGCAGTGTCTTGGG - Intergenic
1114031219 14:18582913-18582935 CTCTGCCTTCGCGGTGTCCCCGG + Intergenic
1114706252 14:24729482-24729504 CCCTGCTTTAGCTGTGTCTCAGG - Intergenic
1115229019 14:31137662-31137684 CGCTGCACTCTCCGTGTCCCAGG - Intronic
1116977742 14:51134449-51134471 CACTGCTTTAGCTGTGTCTCAGG - Intergenic
1117156890 14:52950840-52950862 GTCAGCCCGCGCTGTGTCTCGGG - Intronic
1118299367 14:64601671-64601693 CGCTGCACTCGCTGGGTCTTGGG + Intergenic
1118774575 14:68965695-68965717 CTCTGCATTCACTCTGGCTCTGG - Intronic
1119207051 14:72802237-72802259 CTCTGCACTCGCTGGTCCTGTGG - Intronic
1119386171 14:74259192-74259214 CACTGGACTAGCAGTGTCTCTGG - Intronic
1121491462 14:94364185-94364207 CTCTGCAGTAGCTGTGACCCAGG + Intergenic
1122126292 14:99580345-99580367 CACTGCACTCACGGTGACTCTGG - Intronic
1124625908 15:31307416-31307438 CTCCGCCCTCGCTGCGTCCCTGG + Intergenic
1125499151 15:40227551-40227573 CCCTGGACTCGCTGGGACTCTGG - Intergenic
1126995059 15:54433265-54433287 TTCTTTTCTCGCTGTGTCTCTGG - Intronic
1127264992 15:57353964-57353986 CTCTGCTCTCACCCTGTCTCTGG + Intergenic
1127942962 15:63719329-63719351 CTCTGCACTAGCTTTTTCTGAGG - Intronic
1131492797 15:92877440-92877462 CTCTGCATTCACTGTGCATCTGG + Intergenic
1132468486 16:88937-88959 CTCTGCCCTCGCTGTTCCCCTGG - Intronic
1132621839 16:871449-871471 CTCTGCCCTTGCTGTCCCTCGGG + Intronic
1132912536 16:2322120-2322142 CACTGCAACCGCTGTGTCCCAGG - Intronic
1137056751 16:35749753-35749775 CTCTGCCCTCGCTGTGACCCGGG + Intergenic
1138387517 16:56646095-56646117 CTCTGCACACACTGTCTCTCTGG - Intronic
1139852479 16:69959521-69959543 CTCTGCACAGCCAGTGTCTCAGG + Exonic
1139881450 16:70182429-70182451 CTCTGCACAGCCAGTGTCTCAGG + Exonic
1140371059 16:74413075-74413097 CTCTGCACAGCCAGTGTCTCAGG - Exonic
1141441699 16:84033473-84033495 CTCAGCTCTCCCCGTGTCTCTGG - Intronic
1141644752 16:85361504-85361526 CTCTGCCCTCTCTGTCTCTCTGG + Intergenic
1141883731 16:86877726-86877748 CTCTGGTCTCTCTGTCTCTCTGG + Intergenic
1141995412 16:87634075-87634097 CTCTGCACCCACTTTGTCCCCGG - Intronic
1143397396 17:6612100-6612122 CTCTGCAACCTCTGGGTCTCCGG + Exonic
1143890313 17:10097711-10097733 CTCTGCCCTCGCTCTGGGTCAGG + Intronic
1144131316 17:12250205-12250227 CTCTGCAGTTGCTGCTTCTCTGG + Intergenic
1145063384 17:19746050-19746072 CTCTGCACCAGGGGTGTCTCAGG + Intronic
1146008630 17:29177921-29177943 ATCTGGACTTGCTGTGTCACAGG - Intronic
1146257791 17:31401579-31401601 CACTGCAGTTGCTGTGGCTCAGG + Intronic
1147129993 17:38401995-38402017 CTCTGCACCCCCTGTGTTACTGG + Exonic
1148677441 17:49453431-49453453 CTCTGAACTCTCCGTCTCTCAGG + Intronic
1151771804 17:76167806-76167828 CTCTGCAAATGCTGAGTCTCTGG - Intronic
1152272446 17:79332587-79332609 CTCTGTTCTCTCTGTCTCTCTGG - Intronic
1152272450 17:79332722-79332744 CTCTGCTCTCTTTGTCTCTCAGG - Intronic
1157407607 18:47436246-47436268 CTCAGCACTTGCTGAGTCACAGG + Intergenic
1157543811 18:48533547-48533569 CTCTGCACTTCCTGTCTTTCAGG + Intergenic
1157614705 18:48979558-48979580 CTGTGCACTGGCTGAGACTCTGG + Intergenic
1159108836 18:64032758-64032780 CTCTGCACAGGCTCTTTCTCTGG - Intergenic
1160701551 19:509908-509930 TTCCCCACTGGCTGTGTCTCTGG - Intronic
1161008789 19:1949987-1950009 CTCTGAACTCGCTGTGGCGAAGG - Intronic
1161180147 19:2875267-2875289 CACTGCAAGCTCTGTGTCTCAGG + Intronic
1162373477 19:10292218-10292240 CTCTGCGCTAGCTGTGGCTGTGG - Exonic
1162446993 19:10729523-10729545 CTCTGCACCTGCTGTTTCCCTGG - Intronic
1162484030 19:10947632-10947654 CACTGCAACCACTGTGTCTCAGG - Intergenic
1165220780 19:34314851-34314873 TGCTGCATTCTCTGTGTCTCTGG + Intronic
1165399042 19:35586045-35586067 GGCTGCACTCTCTGTGTCTTGGG + Intergenic
1167552305 19:50169596-50169618 CTCTGCCCTCACAGTCTCTCTGG + Intergenic
925474555 2:4198423-4198445 CACTGCCCACGCTGTGTCTCAGG - Intergenic
933277955 2:80303097-80303119 CCCTGCACTCGCTCTGCCTGCGG - Exonic
933949851 2:87319613-87319635 CTCTTCACTCTCTATGTCCCAGG + Intergenic
934572736 2:95382896-95382918 CTCTGCCCTGGCTGCCTCTCAGG + Intronic
934580333 2:95432770-95432792 CTGTGCACTCTCTGGGGCTCAGG - Intergenic
934599114 2:95643947-95643969 CTGTGCACTCTCTGGGGCTCAGG + Intergenic
936346114 2:111676703-111676725 CTCTGCTCTGGCTGTGTGTGTGG + Intergenic
936868609 2:117107328-117107350 CTCTGTACTGGCTGAGTCTGGGG - Intergenic
937328264 2:121005216-121005238 CTCTGCACTGGCTGTTCCCCAGG + Intergenic
938496966 2:131802802-131802824 CTCTGCCTTCGCGGTGTCCCCGG - Intergenic
939489501 2:142860208-142860230 CTCTGCACTAGCTGAGACTATGG + Intergenic
943190915 2:184679516-184679538 CTCTGCACTCCCGGGGGCTCAGG + Intronic
945697756 2:213129425-213129447 CTCTGTACTTGCTGTTTCTTTGG - Intronic
1169677738 20:8173215-8173237 CTCAGCAGTCTCAGTGTCTCTGG - Intronic
1170795456 20:19543034-19543056 CTGAGCACTTACTGTGTCTCAGG - Intronic
1171123921 20:22585885-22585907 CTATGCATTCTCTGTGTCTGAGG - Intergenic
1171199460 20:23229626-23229648 CTGTGCACTCGCTGGATCCCTGG + Intergenic
1171236884 20:23534770-23534792 CTCTGCTCTCTCTGAGTCTGGGG + Intergenic
1172026434 20:31951930-31951952 CGCAGCACTCGCTCTGCCTCGGG + Exonic
1173840726 20:46155014-46155036 CTTTGCACTGGCTTTATCTCTGG + Intergenic
1174183321 20:48688621-48688643 CTCTGAACTCCCTGGGTCCCTGG - Intronic
1174184802 20:48698816-48698838 CTGTGCACTCACTATGTCCCAGG + Intronic
1175840547 20:62024000-62024022 CACTGCAGTCTCTGTGTCCCGGG - Intronic
1177498622 21:21920844-21920866 CTCTGCACACTCTGTGTTCCAGG - Intergenic
1180455331 22:15509971-15509993 CTCTGCCTTCGCGGTGTCCCCGG + Intergenic
1181270699 22:21657135-21657157 CTCTGTACTCGCTGCATCTCCGG - Intronic
1182114351 22:27746814-27746836 CTCTGCAGTCACTGGGTCTCCGG - Intergenic
1182857499 22:33530921-33530943 CTCTGCAATTCCTGAGTCTCTGG - Intronic
1182861056 22:33559725-33559747 CTCTGGACATGCTGAGTCTCTGG + Intronic
1182983342 22:34693829-34693851 TTCTGCACTCTCTGTGAGTCTGG - Intergenic
1183210400 22:36447828-36447850 CTCTTCACTGGCTGAGTCTGTGG - Intergenic
1184115088 22:42417592-42417614 CTCTGCCCTCCCTGAGCCTCAGG - Intronic
1184574160 22:45348772-45348794 CACTGCAATCTCTGTCTCTCAGG + Intronic
949868476 3:8566985-8567007 CTCTGCACTTCCTGAGCCTCAGG + Intronic
956163924 3:66382222-66382244 CTCTGCTGTGACTGTGTCTCTGG - Intronic
956875031 3:73454273-73454295 CTCTACACTCTCTGGTTCTCTGG - Intronic
957730152 3:84124762-84124784 CTCTGCACTCTCTGGGGCCCAGG + Intergenic
957891476 3:86364484-86364506 CTCTGCTCTTCCTGTGACTCAGG - Intergenic
959695948 3:109248680-109248702 CACTGCAATCTCTGTCTCTCCGG - Intergenic
960574752 3:119218595-119218617 CTCTGCACTCAGTGTGGCTCTGG - Intronic
961689695 3:128660042-128660064 ATCTCCTCTCGCTGTGTCACAGG - Intronic
963693667 3:148536983-148537005 CTGTGCACTCACTCAGTCTCTGG + Intergenic
965343133 3:167514436-167514458 CACTGCATTAGCTGTGTCCCAGG - Intronic
966256129 3:177918031-177918053 CTCTGCTCTCGCTGAGTCTGGGG - Intergenic
967370745 3:188743006-188743028 CTCTGCACTCACACTGTTTCAGG - Intronic
967414188 3:189198527-189198549 CTGAGCACTCGCTGTGTATGAGG + Intronic
969250911 4:5968182-5968204 CTCTGCTCTCTCTCTGTCTCTGG + Intronic
970687802 4:18588307-18588329 TTCTGCTTTCACTGTGTCTCAGG - Intergenic
973072989 4:45888443-45888465 CACTGCTCCCACTGTGTCTCAGG + Intergenic
973544831 4:51970729-51970751 CACTGCTTTAGCTGTGTCTCAGG + Intergenic
974610405 4:64208892-64208914 CTTTGCAGTGGCTGTGTCTCTGG - Intergenic
978827333 4:113041267-113041289 CTCTTCACTCCCTGCATCTCTGG + Intronic
978841518 4:113219682-113219704 CTCTGCAGATGATGTGTCTCAGG + Intronic
979008760 4:115339666-115339688 CTCTGCAATCTCTGCCTCTCGGG + Intergenic
979572246 4:122241281-122241303 CTCTCCACTCACTATTTCTCGGG - Intronic
982501594 4:156163688-156163710 CTTTGCACTCACTGTGTGCCAGG - Intergenic
985546716 5:513601-513623 CTCAGCATCCACTGTGTCTCAGG - Intronic
987618341 5:20305474-20305496 CGCTGCACTCGCTGGGTCTTGGG + Intronic
987620087 5:20329193-20329215 CTTTGCACTTACTGTCTCTCTGG - Intronic
989662914 5:43818654-43818676 CACTGCAATCTCTGTGTCTCGGG + Intergenic
990485944 5:56259333-56259355 TTCTTTACTCACTGTGTCTCTGG + Intergenic
990554504 5:56917733-56917755 CTCTGGACTCACTCTGTCACTGG - Intergenic
993770304 5:91917473-91917495 CGCTGCACTCGCTTTCTCACCGG + Intergenic
995190664 5:109316329-109316351 CACTGCACCCGCTGTCTCCCAGG - Intergenic
995331979 5:110956525-110956547 CTCTGCACTCTCAGTGGCCCGGG + Intergenic
995954346 5:117757248-117757270 CTAGGCACTCACTGTGTATCAGG - Intergenic
997255626 5:132425818-132425840 CTGTGCATTTGCTGTGACTCAGG + Intronic
997527572 5:134563240-134563262 CACTGCAATCTCTGTCTCTCGGG - Intronic
997879012 5:137573415-137573437 CTGTGGACTCACTGTGACTCTGG - Intronic
1000714477 5:164623539-164623561 CTTTGCACTTGCTGTTTTTCTGG - Intergenic
1000904587 5:166949195-166949217 TTTTGCACTCGCTGTTTCTCGGG - Intergenic
1001637969 5:173226309-173226331 TTCTTCACTTGCTTTGTCTCTGG + Intergenic
1002141921 5:177147179-177147201 CACTGCACCCTCTGTGTCCCAGG + Intronic
1002157196 5:177292353-177292375 CGGTGCACTTGCTGTGTTTCAGG + Intronic
1002907010 6:1457134-1457156 CGCTGCACTCGATTTCTCTCCGG - Intergenic
1005371650 6:25139952-25139974 CGCTGCACTCGCTGGGTCTTGGG - Intergenic
1005399249 6:25414786-25414808 CTGTGAACTCTCTGTGTCTCTGG + Intronic
1006425693 6:33961691-33961713 CTCTGGAGTCCCTGTGTCCCAGG - Intergenic
1007576282 6:42927098-42927120 CTCTGCAATCTCTGTCTCCCAGG + Intergenic
1007663332 6:43499769-43499791 CTCAGCACATGCTGCGTCTCAGG - Intronic
1008040576 6:46794294-46794316 CTCTGCATTCCCAGTGTCTTAGG + Intronic
1011745857 6:90407219-90407241 CTTTGCACTCGTTGTGCATCTGG + Intergenic
1013290765 6:108717165-108717187 CTCTGCTCTGGCTGTGGCCCGGG + Intergenic
1015420126 6:132997872-132997894 CTCTGGAGTCGCAGTGTCTTGGG + Intergenic
1015783895 6:136900836-136900858 CTCTTCTCTTGCTTTGTCTCTGG + Intronic
1017718902 6:157231327-157231349 CTCTGCATCCGCTGTGTGTTGGG - Intergenic
1024268702 7:47626074-47626096 CTCTGCTCTCACTGCATCTCTGG - Intergenic
1024317615 7:48035833-48035855 CTCTGTACTTGCTGTGTCCCTGG + Intronic
1027579696 7:79977766-79977788 CTCTGCACTCGATTTCTCACCGG - Intergenic
1028469553 7:91190563-91190585 CACTGCAATCTCTGTGTCTCAGG + Intronic
1030058927 7:105607722-105607744 CTGTGCACTCCCTGTGACTCTGG - Exonic
1030637984 7:111971678-111971700 CTCTTCTCTTGCTTTGTCTCTGG + Intronic
1033551997 7:142455806-142455828 ATTTGCACTCACTGTGTTTCAGG - Intergenic
1034272079 7:149808250-149808272 CTCTGCAGCACCTGTGTCTCTGG + Intergenic
1035324107 7:158053788-158053810 CTCTGGAGTCTCTGCGTCTCTGG - Intronic
1035324115 7:158053839-158053861 CTCTGGAGTCTCTGCGTCTCTGG - Intronic
1035324126 7:158053924-158053946 CTCTGGAGTCTCTGCGTCTCTGG - Intronic
1036216665 8:6885160-6885182 TGCTGCACTTGCTGTGTCTCTGG - Intergenic
1036621562 8:10427575-10427597 CCCCTCACTCGCTGTGGCTCTGG - Intronic
1036823942 8:11961688-11961710 CCCTGCACTCGCTGTGTGCCAGG - Intergenic
1036828370 8:11998524-11998546 CACTGCTTTAGCTGTGTCTCAGG - Intergenic
1037137856 8:15485027-15485049 CTCTGCCCTAAGTGTGTCTCAGG + Intronic
1037150148 8:15626591-15626613 CTCTGCACTCTCAGTGGCCCAGG + Intronic
1040109248 8:43559230-43559252 CTCTGGACTTGCTGTGACACAGG + Intergenic
1040448648 8:47522086-47522108 CACTGCAATCTCTGTCTCTCAGG - Intronic
1041053024 8:53956028-53956050 CTCAGCACTCACTGGGGCTCGGG + Intronic
1044355550 8:91218401-91218423 ATCTTCACTGGCTGGGTCTCAGG - Intronic
1045224703 8:100232936-100232958 CTGTGCACTCGCTGTGTCCTTGG + Intronic
1045520649 8:102900207-102900229 CTCTTCACTTGCTTTGTATCTGG + Intronic
1047780831 8:128109611-128109633 CTGAGCACTCGCTGTGTGCCAGG + Intergenic
1048229348 8:132621539-132621561 CTCGGAACTCCATGTGTCTCTGG - Intronic
1048631070 8:136243078-136243100 CTTTGCACCCGCTGGGCCTCAGG - Intergenic
1048978725 8:139691246-139691268 CCCTGCACTGGCTGTGTCTGGGG + Intronic
1052552641 9:29970254-29970276 CTCTGCACTCTCAGAGGCTCAGG - Intergenic
1054351087 9:64017169-64017191 CTCTGCCTTCGCGGTGTCCCCGG - Intergenic
1055293258 9:74806604-74806626 CTCTGCACCCTCTGTGTATCAGG + Intronic
1056739160 9:89237749-89237771 GACTGCTCTTGCTGTGTCTCTGG + Intergenic
1057764870 9:97907862-97907884 CTGTGCACTGGCTGTCCCTCAGG + Intronic
1058153319 9:101486100-101486122 CACTGCGCTCGCGGTGTCTTGGG - Intronic
1059166830 9:112085080-112085102 CTTTGCACTCTCAGTGTCTAGGG + Intronic
1060531010 9:124346992-124347014 CTCTGCACTCGCTGTGTCTCTGG - Intronic
1060999800 9:127896725-127896747 CTCTGCTCTGGCTCTCTCTCAGG + Intronic
1061073919 9:128329169-128329191 CTTTGACCTCGCTGAGTCTCAGG + Intronic
1061448631 9:130656439-130656461 CTGAGCACTCGCTGTGTGCCAGG + Intergenic
1062207810 9:135346924-135346946 GTCTGGACTCGCTGGGTCTTTGG - Intergenic
1062267299 9:135693037-135693059 CTCTGCACTCACTGTGCATGGGG - Intergenic
1062697963 9:137885002-137885024 CTCTCCACGCTCTCTGTCTCTGG + Intronic
1188352110 X:29144525-29144547 CACTGCAATCTCTGTCTCTCAGG - Intronic
1192019179 X:67366520-67366542 CACTGCAAGCTCTGTGTCTCGGG - Intergenic
1192984536 X:76382652-76382674 CACTGCTGTAGCTGTGTCTCAGG - Intergenic
1195901003 X:109797225-109797247 TTCTGCACTCACTTTATCTCTGG - Intergenic
1200409475 Y:2847153-2847175 CTCTGAACTCGCTGTGTCCTTGG - Intronic
1200425632 Y:3017662-3017684 CACTGCAATCTCTGTGTCCCAGG + Intergenic