ID: 1060531010

View in Genome Browser
Species Human (GRCh38)
Location 9:124346992-124347014
Sequence CTCTGCACTCGCTGTGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060531010_1060531017 0 Left 1060531010 9:124346992-124347014 CCAGAGACACAGCGAGTGCAGAG No data
Right 1060531017 9:124347015-124347037 CTGGGGTCGGGACAGAGCTAGGG No data
1060531010_1060531018 4 Left 1060531010 9:124346992-124347014 CCAGAGACACAGCGAGTGCAGAG No data
Right 1060531018 9:124347019-124347041 GGTCGGGACAGAGCTAGGGCTGG No data
1060531010_1060531016 -1 Left 1060531010 9:124346992-124347014 CCAGAGACACAGCGAGTGCAGAG No data
Right 1060531016 9:124347014-124347036 GCTGGGGTCGGGACAGAGCTAGG No data
1060531010_1060531020 17 Left 1060531010 9:124346992-124347014 CCAGAGACACAGCGAGTGCAGAG No data
Right 1060531020 9:124347032-124347054 CTAGGGCTGGCTGTGGAGCCAGG No data
1060531010_1060531019 10 Left 1060531010 9:124346992-124347014 CCAGAGACACAGCGAGTGCAGAG No data
Right 1060531019 9:124347025-124347047 GACAGAGCTAGGGCTGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060531010 Original CRISPR CTCTGCACTCGCTGTGTCTC TGG (reversed) Intronic