ID: 1060531018 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:124347019-124347041 |
| Sequence | GGTCGGGACAGAGCTAGGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1060531010_1060531018 | 4 | Left | 1060531010 | 9:124346992-124347014 | CCAGAGACACAGCGAGTGCAGAG | No data | ||
| Right | 1060531018 | 9:124347019-124347041 | GGTCGGGACAGAGCTAGGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1060531018 | Original CRISPR | GGTCGGGACAGAGCTAGGGC TGG | Intronic | ||