ID: 1060531020

View in Genome Browser
Species Human (GRCh38)
Location 9:124347032-124347054
Sequence CTAGGGCTGGCTGTGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060531010_1060531020 17 Left 1060531010 9:124346992-124347014 CCAGAGACACAGCGAGTGCAGAG No data
Right 1060531020 9:124347032-124347054 CTAGGGCTGGCTGTGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060531020 Original CRISPR CTAGGGCTGGCTGTGGAGCC AGG Intronic