ID: 1060533675

View in Genome Browser
Species Human (GRCh38)
Location 9:124365464-124365486
Sequence TGATTGCCAGAGAACCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060533670_1060533675 29 Left 1060533670 9:124365412-124365434 CCATGAACATGGGAAGGAGAAAG 0: 1
1: 0
2: 0
3: 45
4: 445
Right 1060533675 9:124365464-124365486 TGATTGCCAGAGAACCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060533675 Original CRISPR TGATTGCCAGAGAACCTCAC AGG Intronic
No off target data available for this crispr