ID: 1060534875

View in Genome Browser
Species Human (GRCh38)
Location 9:124377252-124377274
Sequence CTGTCCTTACAGCAGGACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060534875 Original CRISPR CTGTCCTTACAGCAGGACTC TGG (reversed) Intronic
900664356 1:3804442-3804464 CTGTCAATGCTGCAGGACTCCGG - Intergenic
902838907 1:19063173-19063195 CTGTCCTGAGAAGAGGACTCAGG + Intergenic
909359316 1:74743029-74743051 CTGACCCAACAACAGGACTCAGG - Intronic
913195910 1:116455632-116455654 CAGTCCTTACAGCAGCTCTTTGG + Intergenic
920230790 1:204468565-204468587 CAGTCCTTACATCAGGAAGCAGG + Intronic
920264475 1:204711678-204711700 CTGTGCTTACATCAGGCCTTGGG + Intergenic
1062948053 10:1475493-1475515 CTGTCCGCACAGCACGACTCTGG - Intronic
1063145961 10:3295463-3295485 CTCTTCTTACAGCAGTTCTCAGG + Intergenic
1066692626 10:38045861-38045883 CTGTCCTTACAGCTGGCCCTAGG + Intronic
1067000150 10:42603240-42603262 CTGTCCTTACAGCTGGCCCTAGG - Intronic
1067550234 10:47229258-47229280 TTGGCCTGACAGCAGAACTCAGG + Intergenic
1067565248 10:47331560-47331582 GGGTCCTTACAGCAGCCCTCAGG + Intergenic
1069912977 10:71771116-71771138 CTGTCCTCACAGGCTGACTCAGG - Intronic
1070140712 10:73735079-73735101 CTGGCCTTGCTCCAGGACTCAGG - Intergenic
1074583563 10:114744852-114744874 CTGCCCTGACATAAGGACTCGGG + Intergenic
1075068239 10:119303927-119303949 GTGTCCCTACAGCCAGACTCAGG + Intronic
1075657101 10:124169228-124169250 CTGTCCCTCCCGCAGGACGCTGG - Intergenic
1076128036 10:127991770-127991792 CTGTCCGTCCAGCAGGGATCTGG + Intronic
1077610819 11:3642253-3642275 CTTTGCTTTCAGCCGGACTCCGG - Exonic
1078594747 11:12675678-12675700 CTTTCTTTAAAGCGGGACTCTGG - Intronic
1087388554 11:97505085-97505107 CTTTAGTTACAGGAGGACTCAGG - Intergenic
1087891500 11:103542517-103542539 CTGCCCTTCCAGCAGGGCTGCGG - Intergenic
1088985050 11:114898561-114898583 CTGTCCTTAGAGCAGGGCCTGGG - Intergenic
1089407723 11:118212348-118212370 CTGTCCTGACACCAGCAGTCAGG + Intronic
1090476532 11:127026964-127026986 CTTTCCTCACTCCAGGACTCAGG + Intergenic
1091218431 11:133917489-133917511 CTTTCCCTACAGCATGACCCAGG + Intronic
1094080163 12:26525966-26525988 CAGTCCTTTGAGCAGCACTCAGG + Intronic
1094175173 12:27533957-27533979 CTGACCTGACAGCAGGACCAGGG - Intronic
1096693278 12:53333951-53333973 ATGTCTTTCCAGCAGGCCTCTGG + Intronic
1097738687 12:63212604-63212626 CTGTCCTTACAACATGACAGTGG + Intergenic
1100744283 12:97628486-97628508 CTGTCATTTCAGAAGGATTCGGG + Intergenic
1102622475 12:114207276-114207298 CTGTCCTAACTCAAGGACTCCGG - Intergenic
1102880848 12:116483370-116483392 CTGTATTTACAGCATGTCTCAGG - Intergenic
1103355594 12:120317454-120317476 CTGTCCTTCCTGCTGGATTCTGG + Intergenic
1104013937 12:124950149-124950171 CTGCCCTTCCAGCAGGAACCGGG + Exonic
1104267369 12:127246458-127246480 ATGTCACTAAAGCAGGACTCAGG + Intergenic
1105217813 13:18299777-18299799 GTGTCCTTGCAGGAGGACACTGG - Intergenic
1105547181 13:21359419-21359441 CTGTCCTTCCTCCAGGAGTCTGG - Intergenic
1106748006 13:32724476-32724498 CTCTGCTTGCAGCAGGAATCAGG + Intronic
1113579284 13:111417477-111417499 CTGTCCAGACAGCTGGACTCCGG - Intergenic
1114474186 14:22982335-22982357 CTTTCCCTGCAGCCGGACTCTGG + Exonic
1116801694 14:49450682-49450704 CTGCCCTTACAGCAGGAGACAGG + Intergenic
1122475692 14:102007231-102007253 CTATCCCTACTACAGGACTCAGG - Intronic
1122590811 14:102849383-102849405 CTGTCCAGATGGCAGGACTCTGG + Intronic
1124558678 15:30750539-30750561 CTTACCTTCCAGCAGGTCTCTGG - Intronic
1124672573 15:31655091-31655113 CTTACCTTCCAGCAGGTCTCTGG + Exonic
1125509680 15:40286272-40286294 CTGTCCTCCCAGCAGGCCCCAGG + Intronic
1125721347 15:41846601-41846623 CTCTCCTTCCAGCAGGAATCTGG + Intronic
1130831423 15:87604989-87605011 CTGCCCTGACAGCAGAACTAGGG + Intergenic
1132723814 16:1330235-1330257 CTGTCCTGCCTGCAGGGCTCTGG + Intergenic
1133146790 16:3793308-3793330 TTGTTCTTACAGCAGCTCTCTGG - Intronic
1134881483 16:17748241-17748263 CTGGCATTGCAGCAGGTCTCAGG + Intergenic
1135119837 16:19756267-19756289 CTGTCTTTACTCTAGGACTCAGG - Intronic
1135326898 16:21532025-21532047 CATTCCCTACAGCATGACTCAGG + Intergenic
1136337155 16:29617439-29617461 CATTCCCTACAGCATGACTCAGG + Intergenic
1138251607 16:55506009-55506031 ATTTCCTGACAGAAGGACTCAGG + Exonic
1138406662 16:56800690-56800712 CTGGCATTTCAGCAGGACACTGG - Intronic
1140934630 16:79658907-79658929 CTGTGATTACATCAGGCCTCTGG + Intergenic
1140959407 16:79897656-79897678 CTGGTCTTCCAGCAGGGCTCTGG - Intergenic
1142608525 17:1095586-1095608 TTGTCCCTGCAGCAGGACTGGGG - Intronic
1143394404 17:6580690-6580712 CTGTCCCTCTAGCAGGACTTTGG - Intronic
1145288690 17:21525864-21525886 CTGTCCTGCAAGCAGGATTCTGG - Intronic
1145388983 17:22440530-22440552 CTGTCCTGGGAGCAGGATTCTGG + Intergenic
1146257779 17:31401518-31401540 AGGTCCTTACAGCTGGAATCTGG - Intronic
1150978304 17:70113342-70113364 CTGTACTGACAGCAGGGCTGTGG + Intronic
1151821368 17:76498676-76498698 CTGACCCCAGAGCAGGACTCGGG + Intronic
1152558669 17:81067184-81067206 CCCTCCCTACAGTAGGACTCCGG + Intronic
1152588677 17:81200447-81200469 CTGCCCGGAGAGCAGGACTCAGG + Intronic
1152943733 17:83186852-83186874 TTGTCCTCACAGCAGCTCTCTGG + Intergenic
1153918123 18:9764269-9764291 GTGTCCTCACTGCAGGAATCAGG + Intronic
1156413854 18:36866173-36866195 GTGTCCTTGCAGGAGGACTGGGG - Intronic
1157289625 18:46400292-46400314 CTGTCATCACTGCAGGACACTGG - Intronic
1157366485 18:47069348-47069370 CTGTCCTCACTTCAGGACTGGGG + Intronic
1159832293 18:73292324-73292346 CTGTCCTTACAGAGCAACTCTGG - Intergenic
1161590341 19:5126579-5126601 CTCTCCTGAGAGCAGCACTCCGG - Intronic
1164049117 19:21568914-21568936 CTGCGCTGACAGCAGGACCCTGG - Intergenic
1164272885 19:23688824-23688846 TTCTCCTGACAGCAGGACACAGG - Intergenic
1164282828 19:23783900-23783922 CTCTCCTGAAAGCAGGACACAGG - Intronic
1165983899 19:39750803-39750825 GAGTCCTTACAGCAGAAATCGGG - Intergenic
926048555 2:9728193-9728215 CTATCATTACAGCAGGCCTGCGG + Intergenic
926126722 2:10276782-10276804 CTGTCCTGACAGGAGGGCTTGGG - Intergenic
926616090 2:14998122-14998144 CTGACTTTCCTGCAGGACTCTGG + Intergenic
927813212 2:26191953-26191975 CTGTCCTTCCAGCGGCTCTCTGG + Intronic
932661080 2:73652539-73652561 CTGCCCTTAGAGCAGGCCTGGGG + Intergenic
933765400 2:85705143-85705165 CTGTCATTACAGGATGACTGTGG - Intergenic
936227921 2:110674751-110674773 CTGCCCTTCCAGCAGGATCCAGG + Intronic
939836361 2:147134216-147134238 CTATCTCTTCAGCAGGACTCAGG + Intergenic
943283221 2:185964175-185964197 ATGTCCTTACAGCAGAAATAGGG - Intergenic
946503766 2:220277259-220277281 CTCTCTTTACAGCAGGCCTTGGG + Intergenic
948188661 2:236041869-236041891 CTGTCGTGTCAGCAGGGCTCTGG + Intronic
948358343 2:237398555-237398577 CTCTCCTTAATGCAGGATTCTGG + Intronic
948433135 2:237933361-237933383 ATGCCCTTAAAGCAGGAATCAGG + Intergenic
948759710 2:240183098-240183120 CTGGCCTCCCTGCAGGACTCTGG + Intergenic
1174200535 20:48803674-48803696 ATGTACTAAGAGCAGGACTCAGG - Intronic
1174439958 20:50543254-50543276 CTTTCCTTACAGAAGGACAAAGG + Intronic
1174588094 20:51624268-51624290 CTGTCCTTTCAGCAGGGCCATGG - Intronic
1176065644 20:63193074-63193096 CTGGGCTTACAGCTGGTCTCCGG + Intergenic
1179491445 21:41744052-41744074 CTGCTCTCACAGCTGGACTCTGG - Exonic
1180039284 21:45267743-45267765 CTGTCCTTACTGGAGGATCCCGG - Intronic
1184744950 22:46450760-46450782 CTGTCCTGACAGCAGTGCTGTGG - Intronic
950518421 3:13481819-13481841 CAGTCCTCACAGCAGCCCTCGGG + Intronic
954430503 3:50468313-50468335 CTGGCCTTACAGCAGGACAGCGG - Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
955285921 3:57641936-57641958 CGGTCCTTCCAGCAGCACACAGG + Intronic
955392949 3:58534480-58534502 TTGTCCTTACAGCTAAACTCCGG + Exonic
956040878 3:65143722-65143744 TTGTCCCCACAGCAGGTCTCAGG - Intergenic
956332684 3:68128692-68128714 TGGTACTTAAAGCAGGACTCTGG + Intronic
958017895 3:87964022-87964044 CATTCCTTGCAGCAGGACTCAGG + Intergenic
959090969 3:101902242-101902264 CTGTCCTCTCAGCAGCACTTGGG + Intergenic
959724919 3:109532711-109532733 CAGTGGTTACAGCAGGACTTGGG - Intergenic
961522115 3:127472918-127472940 CAGTCCTCACAGCAGAACTGGGG + Intergenic
961611961 3:128146884-128146906 CAGTCCTTACAGCAGCACAGTGG - Intronic
964397154 3:156257505-156257527 CTGTCCTCAGAGTAGGGCTCTGG - Intronic
967515949 3:190368709-190368731 TTGTCCTGACAGAATGACTCTGG - Intronic
968778375 4:2559765-2559787 CTGTCCGTGCAGCCGGAGTCTGG - Intronic
969348943 4:6586984-6587006 CTGTCTTTGCAGAAGGACACGGG + Exonic
971485189 4:27152815-27152837 CTTTCCACAGAGCAGGACTCTGG + Intergenic
973275719 4:48305777-48305799 ATGTCCTTACACCAAGACTCAGG + Intergenic
984919130 4:184748550-184748572 CTGTCCCTGCAGCTGGGCTCTGG + Intergenic
989669547 5:43899426-43899448 CTGTACTTTCAACAGGATTCTGG + Intergenic
996780850 5:127185122-127185144 CCGGCAGTACAGCAGGACTCTGG + Intergenic
1000026879 5:157366950-157366972 CTGTCCTTCCCGGGGGACTCAGG - Intronic
1001648018 5:173296780-173296802 CTCCCCTTGCAGCAGAACTCTGG - Intergenic
1003404497 6:5817294-5817316 CTGTCCTTCCTCCAGGAGTCTGG + Intergenic
1004003413 6:11616437-11616459 CCCTCCTGGCAGCAGGACTCAGG - Intergenic
1006429748 6:33988332-33988354 CTGGCCTGTCAGCAGGTCTCAGG - Intergenic
1006887327 6:37393533-37393555 CCTTCTTTACAGCAGGGCTCTGG + Exonic
1006920512 6:37624639-37624661 CTGTCCTTATCTCTGGACTCAGG + Intergenic
1007163924 6:39814746-39814768 CACTCCATACAGCAGGGCTCAGG - Intronic
1008688743 6:53953683-53953705 CTGTCCTGGCACCAGGATTCGGG + Intronic
1009657756 6:66568244-66568266 CTGTCCTTTCAGCAGGAAAATGG - Intergenic
1010091789 6:71991563-71991585 ATATCCTTAGAGCAGGAATCCGG - Intronic
1012328974 6:97960519-97960541 CTGTCTTTCCTGCAGGACTCTGG + Intergenic
1013372218 6:109481131-109481153 CAGTCTTTACAGCGGGCCTCAGG + Exonic
1019154347 6:170029225-170029247 GTGTCCTTGCAGCAGGAGGCTGG + Intergenic
1019346864 7:535362-535384 CCGTCCTGACAACTGGACTCGGG + Intergenic
1019801729 7:3092761-3092783 CTGACCCTACAGCAGGACGCAGG + Intergenic
1019933832 7:4241682-4241704 CTCTGCGTGCAGCAGGACTCAGG + Intronic
1025965337 7:66264482-66264504 CTGTCTTTGCAGAAGGGCTCTGG - Intronic
1028108743 7:86912987-86913009 CTGTCCATACATCAGGTCTATGG - Exonic
1028803992 7:95002969-95002991 CTCTCCAACCAGCAGGACTCAGG - Intronic
1033048899 7:137986514-137986536 CTGCCATGACAGCAGGGCTCGGG + Intronic
1033323303 7:140359431-140359453 CTGTCCTCACAGCAGCCCTCTGG - Intronic
1033432672 7:141303462-141303484 CTGTCCGGGCAGCAGGACTCTGG - Intronic
1033540143 7:142349103-142349125 CTCTCCTGACAGCAAGGCTCTGG + Intergenic
1034227771 7:149496976-149496998 CTGTCCTCACAGCAAGCCTGTGG - Intronic
1034242943 7:149624016-149624038 CTGTCCTCACAGCAAGCCTGTGG - Intergenic
1034451411 7:151139112-151139134 CTGTCATTACACCATCACTCAGG - Intronic
1034781130 7:153883852-153883874 CTATCCTTTCTGCAGGGCTCTGG + Intergenic
1037920222 8:22800701-22800723 CTGGGATTACAGCAGGACTGGGG + Intronic
1039506502 8:38056374-38056396 CTGTCCTTACAGCACTCCTGTGG - Intronic
1045101934 8:98853394-98853416 CTGTTCTTACTGCTGGTCTCTGG + Intronic
1050011475 9:1189476-1189498 CTTTGCTTCCAGAAGGACTCAGG - Intergenic
1050083361 9:1938812-1938834 CTCTCCAAACAGCAGGACCCAGG + Intergenic
1051455270 9:17248241-17248263 CTGTCCTTACAGAATGAGTTAGG + Intronic
1053363315 9:37504963-37504985 CTGTCCTTATAGCACCGCTCTGG - Intergenic
1053513359 9:38708378-38708400 CTGTCATTCCAGCAGGAACCGGG + Intergenic
1055135592 9:72825299-72825321 CTATGCCTACAGCAGGACTATGG + Intronic
1056329869 9:85512256-85512278 CTTTCCTTACAGCAGCAGTGTGG - Intergenic
1056859385 9:90165769-90165791 CTTTCTTTACAGCAGGATCCTGG + Intergenic
1060534875 9:124377252-124377274 CTGTCCTTACAGCAGGACTCTGG - Intronic
1062067682 9:134537481-134537503 CTCTCCATAGAGCAGGTCTCAGG + Intergenic
1062409532 9:136415970-136415992 GTGTCCTCACAGCAGCACTTGGG + Intronic
1185839775 X:3378237-3378259 CTATCCTCACAGAAGCACTCAGG + Intergenic
1186101641 X:6163664-6163686 CTGTCTTTACAGAAGTCCTCTGG - Intronic
1186327726 X:8498118-8498140 CTGTCCTGACAGCAGATCGCAGG + Intergenic
1195999034 X:110761429-110761451 CAGTCCTTACAAAAGGTCTCAGG + Intronic
1197356157 X:125439143-125439165 CTGTCCTAACAGCAGGAAAATGG - Intergenic
1201434286 Y:13939923-13939945 CTGTCCTGACAGCAGATCACAGG - Intergenic