ID: 1060535332

View in Genome Browser
Species Human (GRCh38)
Location 9:124382008-124382030
Sequence TACCTTGGCCTCCCAAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4672
Summary {0: 2, 1: 30, 2: 239, 3: 1298, 4: 3103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060535332_1060535340 25 Left 1060535332 9:124382008-124382030 CCAGCCTTTGGGAGGCCAAGGTA 0: 2
1: 30
2: 239
3: 1298
4: 3103
Right 1060535340 9:124382056-124382078 CCAGACCCACCTGGGCAGCATGG No data
1060535332_1060535337 16 Left 1060535332 9:124382008-124382030 CCAGCCTTTGGGAGGCCAAGGTA 0: 2
1: 30
2: 239
3: 1298
4: 3103
Right 1060535337 9:124382047-124382069 TCAGGAGTTCCAGACCCACCTGG No data
1060535332_1060535336 -2 Left 1060535332 9:124382008-124382030 CCAGCCTTTGGGAGGCCAAGGTA 0: 2
1: 30
2: 239
3: 1298
4: 3103
Right 1060535336 9:124382029-124382051 TAGGCAGACTGCTTGAGCTCAGG 0: 4
1: 162
2: 1465
3: 6141
4: 20371
1060535332_1060535338 17 Left 1060535332 9:124382008-124382030 CCAGCCTTTGGGAGGCCAAGGTA 0: 2
1: 30
2: 239
3: 1298
4: 3103
Right 1060535338 9:124382048-124382070 CAGGAGTTCCAGACCCACCTGGG 0: 4
1: 147
2: 3551
3: 35470
4: 66907

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060535332 Original CRISPR TACCTTGGCCTCCCAAAGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr