ID: 1060538413

View in Genome Browser
Species Human (GRCh38)
Location 9:124411470-124411492
Sequence CATTCTACACAGAAGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060538400_1060538413 26 Left 1060538400 9:124411421-124411443 CCCCTTTAATTCTCACAACCACC 0: 1
1: 7
2: 44
3: 159
4: 559
Right 1060538413 9:124411470-124411492 CATTCTACACAGAAGGAAAAAGG No data
1060538401_1060538413 25 Left 1060538401 9:124411422-124411444 CCCTTTAATTCTCACAACCACCC 0: 5
1: 13
2: 66
3: 270
4: 843
Right 1060538413 9:124411470-124411492 CATTCTACACAGAAGGAAAAAGG No data
1060538410_1060538413 3 Left 1060538410 9:124411444-124411466 CCACTAGGGGCAGGTATTATGAT 0: 1
1: 0
2: 0
3: 13
4: 99
Right 1060538413 9:124411470-124411492 CATTCTACACAGAAGGAAAAAGG No data
1060538408_1060538413 5 Left 1060538408 9:124411442-124411464 CCCCACTAGGGGCAGGTATTATG 0: 1
1: 0
2: 0
3: 10
4: 70
Right 1060538413 9:124411470-124411492 CATTCTACACAGAAGGAAAAAGG No data
1060538409_1060538413 4 Left 1060538409 9:124411443-124411465 CCCACTAGGGGCAGGTATTATGA 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1060538413 9:124411470-124411492 CATTCTACACAGAAGGAAAAAGG No data
1060538407_1060538413 8 Left 1060538407 9:124411439-124411461 CCACCCCACTAGGGGCAGGTATT 0: 1
1: 0
2: 1
3: 3
4: 77
Right 1060538413 9:124411470-124411492 CATTCTACACAGAAGGAAAAAGG No data
1060538402_1060538413 24 Left 1060538402 9:124411423-124411445 CCTTTAATTCTCACAACCACCCC 0: 1
1: 6
2: 16
3: 89
4: 547
Right 1060538413 9:124411470-124411492 CATTCTACACAGAAGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060538413 Original CRISPR CATTCTACACAGAAGGAAAA AGG Intronic
No off target data available for this crispr