ID: 1060540453

View in Genome Browser
Species Human (GRCh38)
Location 9:124426524-124426546
Sequence TTCTCAGGGCATCACGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060540444_1060540453 -3 Left 1060540444 9:124426504-124426526 CCTTGTGATGACACCCGTCCTTC No data
Right 1060540453 9:124426524-124426546 TTCTCAGGGCATCACGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060540453 Original CRISPR TTCTCAGGGCATCACGGGAA GGG Intergenic
No off target data available for this crispr