ID: 1060540500

View in Genome Browser
Species Human (GRCh38)
Location 9:124426887-124426909
Sequence GGTACCACTGCACTCCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060540500_1060540505 9 Left 1060540500 9:124426887-124426909 CCAACCTGGAGTGCAGTGGTACC No data
Right 1060540505 9:124426919-124426941 CATTGCAGCTTCTGCCTCCTGGG 0: 5
1: 251
2: 5809
3: 47597
4: 132718
1060540500_1060540504 8 Left 1060540500 9:124426887-124426909 CCAACCTGGAGTGCAGTGGTACC No data
Right 1060540504 9:124426918-124426940 TCATTGCAGCTTCTGCCTCCTGG 0: 7
1: 400
2: 9069
3: 67693
4: 124587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060540500 Original CRISPR GGTACCACTGCACTCCAGGT TGG (reversed) Intergenic
No off target data available for this crispr