ID: 1060541635

View in Genome Browser
Species Human (GRCh38)
Location 9:124434599-124434621
Sequence CCCCTCTTACCTGTTGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060541629_1060541635 23 Left 1060541629 9:124434553-124434575 CCATGTGTCCGATTGTGATGCTT No data
Right 1060541635 9:124434599-124434621 CCCCTCTTACCTGTTGCCATGGG No data
1060541630_1060541635 15 Left 1060541630 9:124434561-124434583 CCGATTGTGATGCTTTAGCATGC No data
Right 1060541635 9:124434599-124434621 CCCCTCTTACCTGTTGCCATGGG No data
1060541632_1060541635 -7 Left 1060541632 9:124434583-124434605 CCGGACATGATCGCTGCCCCTCT No data
Right 1060541635 9:124434599-124434621 CCCCTCTTACCTGTTGCCATGGG No data
1060541628_1060541635 26 Left 1060541628 9:124434550-124434572 CCACCATGTGTCCGATTGTGATG No data
Right 1060541635 9:124434599-124434621 CCCCTCTTACCTGTTGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060541635 Original CRISPR CCCCTCTTACCTGTTGCCAT GGG Intergenic
No off target data available for this crispr