ID: 1060543583

View in Genome Browser
Species Human (GRCh38)
Location 9:124447900-124447922
Sequence CTGTAGAAGAAGAAACAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060543582_1060543583 6 Left 1060543582 9:124447871-124447893 CCTGAGAGAAAGAGGTGATTCTC No data
Right 1060543583 9:124447900-124447922 CTGTAGAAGAAGAAACAGAGTGG No data
1060543581_1060543583 7 Left 1060543581 9:124447870-124447892 CCCTGAGAGAAAGAGGTGATTCT No data
Right 1060543583 9:124447900-124447922 CTGTAGAAGAAGAAACAGAGTGG No data
1060543579_1060543583 20 Left 1060543579 9:124447857-124447879 CCATGCTTTATGTCCCTGAGAGA No data
Right 1060543583 9:124447900-124447922 CTGTAGAAGAAGAAACAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060543583 Original CRISPR CTGTAGAAGAAGAAACAGAG TGG Intergenic
No off target data available for this crispr