ID: 1060544703

View in Genome Browser
Species Human (GRCh38)
Location 9:124453128-124453150
Sequence CCGCGTGTACTCACGTGCAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 38}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060544701_1060544703 -4 Left 1060544701 9:124453109-124453131 CCTGAGCTGGCAGCGCTGACCGC 0: 1
1: 0
2: 0
3: 12
4: 117
Right 1060544703 9:124453128-124453150 CCGCGTGTACTCACGTGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 38
1060544697_1060544703 24 Left 1060544697 9:124453081-124453103 CCGGGCGGCGCGGCTGCGGAGCC 0: 1
1: 0
2: 3
3: 28
4: 235
Right 1060544703 9:124453128-124453150 CCGCGTGTACTCACGTGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 38
1060544699_1060544703 3 Left 1060544699 9:124453102-124453124 CCCTCTGCCTGAGCTGGCAGCGC 0: 1
1: 0
2: 1
3: 10
4: 170
Right 1060544703 9:124453128-124453150 CCGCGTGTACTCACGTGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 38
1060544700_1060544703 2 Left 1060544700 9:124453103-124453125 CCTCTGCCTGAGCTGGCAGCGCT 0: 1
1: 0
2: 0
3: 21
4: 181
Right 1060544703 9:124453128-124453150 CCGCGTGTACTCACGTGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060544703 Original CRISPR CCGCGTGTACTCACGTGCAG TGG Exonic
900202657 1:1418065-1418087 ACGCGTCTACTCAGGTGGAGTGG + Intergenic
905231835 1:36519251-36519273 GCGCGCGCGCTCACGTGCAGGGG + Intergenic
1065176972 10:23087113-23087135 CAGAGTGTACTAACATGCAGAGG - Intergenic
1080725062 11:34889710-34889732 CCGCATGTTCTCACTTACAGTGG - Intronic
1083896737 11:65623953-65623975 CCATGGGTACTCACGTGCATGGG - Exonic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1095408992 12:41901633-41901655 CCACGTGTTCTCACTTACAGAGG + Intergenic
1101571815 12:105960464-105960486 CTCTGTGTACTCACTTGCAGAGG - Intergenic
1109096741 13:58128335-58128357 CTGCGTGTTCTCACTTACAGCGG - Intergenic
1119624463 14:76160092-76160114 TCGAGTGCACTCAAGTGCAGTGG - Intronic
1122893142 14:104742202-104742224 CCGTGTGAGCTCACGTGCTGTGG - Intronic
1127361197 15:58246526-58246548 CCGTGGTTGCTCACGTGCAGAGG + Intronic
1129016456 15:72473790-72473812 CCACTTGTACAGACGTGCAGTGG - Intergenic
1132409670 15:101567388-101567410 CCGCGGGGACCCACATGCAGGGG + Intergenic
1133229633 16:4360430-4360452 CCCTGTGTGCTCACCTGCAGGGG + Exonic
1136129769 16:28212145-28212167 CCGCGTGGACGCACGGGCGGTGG - Intergenic
1139668292 16:68473490-68473512 CCTTGTGTCCCCACGTGCAGTGG + Intergenic
1142504095 17:351950-351972 CGGCCTGTACGCACATGCAGGGG - Intronic
1152849011 17:82620524-82620546 CCGCGTGTCCCCACGTGCTGAGG + Intronic
1155474752 18:26226755-26226777 GCGCGTGTCCTGCCGTGCAGCGG + Exonic
1155505537 18:26529116-26529138 CCTCTTGTACTCCCCTGCAGTGG + Intronic
1157622622 18:49025142-49025164 CCGGGTGTATTCACGCGCTGAGG - Intergenic
1159431913 18:68363022-68363044 CAGCTTGTACCCACGTTCAGTGG - Intergenic
1160690726 19:459871-459893 CCGTGTGAAGTCACCTGCAGGGG - Intronic
943642983 2:190379312-190379334 CCGCGTGTACTCATGTGACAAGG - Intergenic
947751304 2:232534127-232534149 CAGCGGGGACCCACGTGCAGTGG - Exonic
1176407519 21:6429459-6429481 CCGTATGTACTTACGTGCACTGG + Intergenic
1179683022 21:43037862-43037884 CCGTATGTACTTACGTGCACTGG + Intergenic
960617899 3:119613026-119613048 CCTGGTGTACTCAGGTCCAGCGG - Exonic
960906426 3:122606242-122606264 CCACATGTACTCATGTGGAGGGG + Intronic
967200287 3:187066851-187066873 ACGCCTGTACTTACCTGCAGGGG - Intronic
972639577 4:40913418-40913440 CCGAGTGGACTCATGTGCAAAGG - Intronic
992380054 5:76227915-76227937 CCGCGTGTAAGCTCCTGCAGAGG - Intronic
1022026179 7:26449786-26449808 CCGCCTGTCCTCACAGGCAGAGG + Intergenic
1024381742 7:48704442-48704464 CAATGTGTACTGACGTGCAGAGG + Intergenic
1034282252 7:149862486-149862508 CCACGTGTACTTACTTGCAGGGG - Exonic
1035331113 7:158098129-158098151 GCGTGTGTGCTCATGTGCAGGGG - Intronic
1035453531 7:158994982-158995004 CCGCGTGTTCTCACTTACAGTGG + Intergenic
1059484911 9:114619270-114619292 ACGCGTGCACGCACGCGCAGAGG - Intronic
1060540921 9:124429543-124429565 CTGCGTGTGCCCACGGGCAGAGG + Intergenic
1060544703 9:124453128-124453150 CCGCGTGTACTCACGTGCAGTGG + Exonic
1188931444 X:36116291-36116313 CCACGTGTTCTCACTTGTAGTGG - Intronic