ID: 1060544782

View in Genome Browser
Species Human (GRCh38)
Location 9:124453454-124453476
Sequence CAGGATCAGGACTCTCTGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 180}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060544770_1060544782 10 Left 1060544770 9:124453421-124453443 CCGGTGCCGTCCGGCGGCATCCT 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1060544782 9:124453454-124453476 CAGGATCAGGACTCTCTGGGCGG 0: 1
1: 0
2: 1
3: 21
4: 180
1060544766_1060544782 18 Left 1060544766 9:124453413-124453435 CCGGCCACCCGGTGCCGTCCGGC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1060544782 9:124453454-124453476 CAGGATCAGGACTCTCTGGGCGG 0: 1
1: 0
2: 1
3: 21
4: 180
1060544772_1060544782 4 Left 1060544772 9:124453427-124453449 CCGTCCGGCGGCATCCTGGTGCT 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1060544782 9:124453454-124453476 CAGGATCAGGACTCTCTGGGCGG 0: 1
1: 0
2: 1
3: 21
4: 180
1060544777_1060544782 -10 Left 1060544777 9:124453441-124453463 CCTGGTGCTGGGCCAGGATCAGG 0: 1
1: 1
2: 2
3: 47
4: 489
Right 1060544782 9:124453454-124453476 CAGGATCAGGACTCTCTGGGCGG 0: 1
1: 0
2: 1
3: 21
4: 180
1060544768_1060544782 14 Left 1060544768 9:124453417-124453439 CCACCCGGTGCCGTCCGGCGGCA 0: 1
1: 0
2: 0
3: 8
4: 64
Right 1060544782 9:124453454-124453476 CAGGATCAGGACTCTCTGGGCGG 0: 1
1: 0
2: 1
3: 21
4: 180
1060544769_1060544782 11 Left 1060544769 9:124453420-124453442 CCCGGTGCCGTCCGGCGGCATCC 0: 1
1: 0
2: 1
3: 2
4: 43
Right 1060544782 9:124453454-124453476 CAGGATCAGGACTCTCTGGGCGG 0: 1
1: 0
2: 1
3: 21
4: 180
1060544775_1060544782 0 Left 1060544775 9:124453431-124453453 CCGGCGGCATCCTGGTGCTGGGC 0: 1
1: 0
2: 0
3: 18
4: 197
Right 1060544782 9:124453454-124453476 CAGGATCAGGACTCTCTGGGCGG 0: 1
1: 0
2: 1
3: 21
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060544782 Original CRISPR CAGGATCAGGACTCTCTGGG CGG Exonic
900105838 1:980647-980669 CAGGATGAGAACTGGCTGGGAGG + Exonic
900406564 1:2495536-2495558 GAGGGTCAGGACTCCCCGGGAGG + Exonic
900794621 1:4700559-4700581 CAGGATCAGAACTCACTGGCTGG - Intronic
901320237 1:8335608-8335630 CAGGACCAGGACTCACGGGGAGG - Intronic
902287582 1:15416503-15416525 GTGGCTCAGGACTCCCTGGGCGG - Intronic
902472295 1:16657279-16657301 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
902486508 1:16750167-16750189 CAGGCTCAGGCCTCTGTAGGGGG - Intronic
906098261 1:43238804-43238826 GAGGAGCAGGGCTCTCTGGATGG + Intronic
915416647 1:155747754-155747776 CAGGATCTGGAAGCCCTGGGCGG - Intergenic
915669863 1:157479204-157479226 CAGGACCCTGACTCTGTGGGAGG + Intergenic
915928142 1:160040198-160040220 CAGGAGCAGAACTCTGTGGCTGG - Exonic
917415033 1:174800233-174800255 CAGGTTTAGGTCTCCCTGGGAGG - Intronic
917976741 1:180244816-180244838 CAGGAGCTGGACTCCCAGGGGGG - Intronic
922915883 1:229257391-229257413 CAGGATTAGAACTTTCTGAGGGG + Intergenic
924058899 1:240151718-240151740 AAGGAGCAGAACTCTCTGTGTGG + Intronic
1063520389 10:6735771-6735793 CAGGATGAGGACCCACTGGATGG + Intergenic
1065801737 10:29358637-29358659 CAGGCTCAGAGATCTCTGGGAGG + Intergenic
1067747943 10:48950542-48950564 CAGGATACTGAGTCTCTGGGAGG + Intronic
1070705385 10:78634020-78634042 CATGATTACGACTCTATGGGTGG - Intergenic
1074152871 10:110773721-110773743 CAGGATCAGTTCTCTTTGGCAGG + Intronic
1074437486 10:113446347-113446369 CAGCATCAGGACCCACTTGGGGG - Intergenic
1075859608 10:125662954-125662976 CTGAAGCAGGACTCTCTAGGAGG + Intronic
1076510707 10:131012022-131012044 CAGGCCCAGGAATCTCTGAGTGG - Intergenic
1077200615 11:1305696-1305718 CAGGAACAGGCCTCTCAGGGAGG + Intronic
1078089838 11:8258222-8258244 CCTGATCAGGGCTTTCTGGGAGG + Intronic
1078916539 11:15783837-15783859 CAGTGTCAGACCTCTCTGGGAGG - Intergenic
1079981106 11:27152305-27152327 TAGGATCTAGATTCTCTGGGTGG - Intergenic
1084219504 11:67668399-67668421 AAGGATCAGGACCCTGGGGGTGG + Intronic
1084474523 11:69381216-69381238 CAGGATCGGGGCCCCCTGGGAGG + Intergenic
1085394550 11:76200719-76200741 CAGGCTCAGGACGGGCTGGGTGG - Intronic
1088945762 11:114511231-114511253 CATGATCAGAAGTCACTGGGTGG + Intergenic
1090187187 11:124746311-124746333 CAGTACCAGGATTCTTTGGGCGG - Intronic
1093207603 12:16269225-16269247 CTGGATCAGAATTTTCTGGGAGG - Intronic
1099309473 12:81000124-81000146 CGGAATCATGAATCTCTGGGAGG + Intronic
1100441766 12:94623802-94623824 GAGGACCAGGAAGCTCTGGGTGG + Intronic
1104814452 12:131637749-131637771 CAGGCTCAGGGCCCTGTGGGAGG + Intergenic
1104969418 12:132524446-132524468 CAGCAACAGGCCTCCCTGGGTGG - Intronic
1105877386 13:24570648-24570670 CAGGACCAGGACCCACTGGTGGG - Intergenic
1107977733 13:45706072-45706094 TAGCAACAGGTCTCTCTGGGTGG - Intronic
1108253863 13:48592256-48592278 CAGGATCAGGAGGCCCTGGAAGG + Intergenic
1109651810 13:65336880-65336902 CAGCCTCAGGCCTCTCTTGGGGG - Intergenic
1115017321 14:28633366-28633388 CAGCCACAGGACTCCCTGGGTGG + Intergenic
1117999768 14:61511853-61511875 CGGGATCCCGACTCTGTGGGTGG + Intronic
1118546051 14:66890345-66890367 CATGATCAGGGCTCACTGTGTGG - Intronic
1119131653 14:72178362-72178384 CAGAATCAGGACTGTCTGAGGGG - Intronic
1121557685 14:94850712-94850734 CAGGGCGAGGCCTCTCTGGGTGG + Intergenic
1121616777 14:95319113-95319135 CAGGATCAGGACTCTAACTGGGG - Intronic
1122140379 14:99659854-99659876 CAGGGTCAGGGATCTCCGGGGGG - Intronic
1122449826 14:101796715-101796737 CAGTCTCAGCTCTCTCTGGGTGG + Intronic
1122906975 14:104806103-104806125 CATGATCGGGCCTCTGTGGGGGG - Intergenic
1124400776 15:29345662-29345684 CAGGAGAAGGAATCCCTGGGGGG - Intronic
1124475160 15:30026790-30026812 CAGGACCAGGAAGCTCTGGGAGG + Intergenic
1126414754 15:48406122-48406144 CAGTATCAGGACTCTCAGGCAGG + Intergenic
1126898465 15:53286073-53286095 CAGGTACAGGACTCTCAGGAGGG + Intergenic
1127289062 15:57554333-57554355 CAGGGTAAGGCCACTCTGGGTGG - Intergenic
1127309704 15:57741537-57741559 AAAGATCAGGAGTCACTGGGTGG - Intronic
1128543185 15:68551055-68551077 GAGGTTCCTGACTCTCTGGGGGG + Intergenic
1129600065 15:76993569-76993591 CTGGAGCAGAAGTCTCTGGGAGG + Intronic
1129686146 15:77687125-77687147 CAGGATCAGGGCTCAGTGTGAGG + Intronic
1129686160 15:77687219-77687241 CAGGATCAGGGCTCAGTGTGAGG + Intronic
1129769305 15:78193396-78193418 GAGGATGAGGACACTCTGGATGG + Intronic
1129994161 15:79990485-79990507 CAGCATCAGGACAGTTTGGGGGG + Intergenic
1130136028 15:81182784-81182806 CAGGATCAGGGGTCCATGGGAGG - Intronic
1130997566 15:88912472-88912494 CAGGGCCAGGACTCTTTAGGTGG - Intronic
1134038032 16:11046765-11046787 CAGGGTCATGACTGCCTGGGAGG - Intronic
1136363899 16:29799619-29799641 CACCCTCAGGACTCTCTGGGTGG + Exonic
1136419387 16:30122712-30122734 GAGGATGAGTACTCTCGGGGAGG - Intronic
1138198753 16:55073683-55073705 CAGGAGCAGGATTCAGTGGGGGG + Intergenic
1141997022 16:87642082-87642104 AAGGATCAGGACCCTTTGGGGGG + Intronic
1142597412 17:1036300-1036322 TGGGCTCTGGACTCTCTGGGCGG - Intronic
1143781223 17:9230662-9230684 CAGGCCCAGGAGGCTCTGGGGGG + Intronic
1146836807 17:36117584-36117606 CAGGATCTGGACTTTTTGAGAGG - Intergenic
1147132704 17:38418614-38418636 CAGGAACATGGCTCACTGGGTGG + Intergenic
1147215560 17:38897073-38897095 CAGGTTCTGGACTCTTGGGGTGG + Intronic
1147690755 17:42313041-42313063 CAGGACGAGGCCGCTCTGGGGGG + Intergenic
1149664282 17:58354866-58354888 CAGGAGCAGGACTCTGTGCCAGG + Exonic
1150223813 17:63511922-63511944 CAGGAGCAGGTCTCCCTGGTGGG + Intronic
1151220314 17:72606672-72606694 CAGGAGCATGACTCTGTTGGGGG - Intergenic
1151803541 17:76391603-76391625 CAGGATCAGACCTGTGTGGGCGG + Exonic
1152244800 17:79179746-79179768 CATCAGCAGGACTCTCTGGGAGG - Intronic
1152285910 17:79413322-79413344 CAGGATGTGGAGTCTCTGAGTGG + Intronic
1152694189 17:81735434-81735456 CAGGCTCAGGACCTCCTGGGGGG + Intergenic
1152801831 17:82334236-82334258 CAGGTGCAGGACCCTCTGCGGGG - Intergenic
1157564521 18:48670780-48670802 GAGGATCAGGACTCCAGGGGTGG - Intronic
1158474942 18:57771632-57771654 CAGCAGCAGGAGTTTCTGGGTGG + Intronic
1160591275 18:79945882-79945904 CAGCCTCAGGTCTCTGTGGGTGG - Intronic
1161596143 19:5151988-5152010 CAGAACCAGGATTCTCTGAGAGG + Exonic
1161872270 19:6879275-6879297 GAGGATCAGGAGTCTGGGGGTGG + Intergenic
1163593110 19:18205184-18205206 GGGGATCAGGACTCTCCTGGGGG - Intergenic
1163618324 19:18342562-18342584 CAGGATCAGGACCTTTTCGGAGG + Intronic
1165406222 19:35632942-35632964 CAGGATAGGGGCCCTCTGGGGGG - Exonic
1165779470 19:38423895-38423917 CAGGAACAGCAGCCTCTGGGAGG - Intronic
1166040308 19:40198363-40198385 CAGGATCAGGACTGTGGGGTGGG - Exonic
1166103905 19:40588325-40588347 CAGGAGCAGGGACCTCTGGGAGG + Intronic
1166644692 19:44522898-44522920 CAGGATCAGGACCATCTGAGAGG + Exonic
1166980282 19:46627908-46627930 CAGGACCAGGCCTCCCTGAGGGG + Intergenic
1202704692 1_KI270713v1_random:14073-14095 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
926009376 2:9396177-9396199 AAGGCTCAGGACCCTCTGGAAGG - Intronic
926229329 2:10990788-10990810 CAGGGTCAGGACCAGCTGGGAGG + Intergenic
926420078 2:12687377-12687399 CAGGATATGGCCTCTTTGGGAGG - Intergenic
926878796 2:17518040-17518062 CAGAATCAGGACTTTGTGAGGGG + Exonic
927706459 2:25299349-25299371 CAGGCTGAGGAGTCTCTGTGAGG - Intronic
927909650 2:26887881-26887903 CAGGATCAGAATCCTCTTGGAGG + Intronic
928111943 2:28517500-28517522 CAGGCTCAGGACACTCTGGTAGG + Intronic
931771350 2:65500717-65500739 CAGGATCAGGCCTCCCTGCATGG - Intergenic
933942434 2:87255680-87255702 CAGGCTAAGGACACTCCGGGCGG - Intergenic
936337791 2:111605888-111605910 CAGGCTAAGGACACTCCGGGCGG + Intergenic
942449917 2:176102301-176102323 AAGGCTCAGGGCTCTCTGTGAGG - Intergenic
946894929 2:224313956-224313978 CAGGATCAGGACTCTGGGGAAGG - Intergenic
947639685 2:231700090-231700112 CAGGATCAGGACCCCTCGGGAGG - Intergenic
947708132 2:232292913-232292935 CAGGAACAGGCTTCCCTGGGTGG - Intronic
947718378 2:232352891-232352913 CAGGATCAGCTCTCCCCGGGGGG + Intergenic
948420757 2:237859015-237859037 GAGGAACAGGGCTCTTTGGGGGG - Intronic
949069239 2:242013479-242013501 CAGCTGCAGGCCTCTCTGGGGGG + Intergenic
1170810932 20:19673917-19673939 CAGGATCTGGCAGCTCTGGGAGG + Intronic
1171232595 20:23499645-23499667 CAGGCTCAGGATTCACAGGGGGG + Intergenic
1173546445 20:43901909-43901931 CAGGATCAGGGGTCTAAGGGTGG - Intergenic
1174040154 20:47693952-47693974 AAGAATCAGGACTGTCTTGGTGG + Intronic
1176093854 20:63330616-63330638 CAGGATGCGGGCTCTCAGGGTGG + Intronic
1176310631 21:5147140-5147162 CACCATCAGGACTGGCTGGGTGG - Intronic
1178277902 21:31255517-31255539 GAGGATCAGGATTCTCAGGTGGG - Intronic
1178834434 21:36084573-36084595 CTGGATCAAGACTTTTTGGGAGG - Intergenic
1179846424 21:44114895-44114917 CACCATCAGGACTGGCTGGGTGG + Intronic
1181031236 22:20149665-20149687 GAGGAGCAGGACCCACTGGGTGG + Intronic
1181539007 22:23563245-23563267 CAGGATCAAAACCCTCTGGTCGG - Intergenic
1183248245 22:36710313-36710335 GTGGCTCAGGACTCTCTTGGGGG - Intergenic
1183499584 22:38170478-38170500 CAGGAGCAGCAGTGTCTGGGTGG + Intronic
1185143972 22:49119377-49119399 CAGGAGCTGGACTGACTGGGTGG - Intergenic
949097746 3:106205-106227 CATGATAAAGACTCACTGGGTGG - Intergenic
949728923 3:7084371-7084393 CAGCATCAGAACTTTCTGGGAGG - Intronic
950693600 3:14680834-14680856 CAGGATCAGATCCCTCTGGCTGG + Intronic
951647936 3:24914398-24914420 CAGGATAAGGCCTATCTGAGAGG - Intergenic
952955219 3:38552744-38552766 TAGGGTCAGGAATCTCTGGGGGG - Intronic
954613953 3:51960083-51960105 CAGGCTCAGAGCTCTCTAGGTGG + Intronic
954825715 3:53371628-53371650 AAGGATGAGGGGTCTCTGGGCGG - Intergenic
955377465 3:58410202-58410224 CAGGATCAGGAGTCTCTAGTTGG + Intronic
958878832 3:99646025-99646047 CAGGTTCTGGACCCTCTGGGTGG - Intronic
962300982 3:134243005-134243027 CAGGATCTGGGCCCTCTGGCAGG + Intronic
963248668 3:143085068-143085090 CAGGCTCTGGACTCCCTGGTGGG + Intergenic
969522192 4:7684884-7684906 CAGGGTCAGGGCTCTCTGGGAGG - Intronic
969676599 4:8617831-8617853 CAGGATCAGGCAGCTTTGGGAGG + Intronic
971887309 4:32468553-32468575 CAGAAGCAGTACTATCTGGGAGG - Intergenic
977655487 4:99516536-99516558 CAGGAGCTGGACTATCTGGCTGG + Intronic
980896462 4:138865359-138865381 GAGGATCAGGGCTGTCTGGAAGG - Intergenic
984682252 4:182623925-182623947 CAGGCACAGGAATCTCTGCGAGG + Intronic
985169048 4:187128627-187128649 CAGGGTTAGCACTCTCTGGCTGG - Intergenic
985948097 5:3202219-3202241 CAGGTGCAGGGCTCTCTGAGAGG - Intergenic
986200928 5:5577612-5577634 AAGAATCATGCCTCTCTGGGTGG + Intergenic
986292336 5:6410268-6410290 CATGATCTGGACTGGCTGGGAGG + Intergenic
988451877 5:31351875-31351897 AAGAAAGAGGACTCTCTGGGGGG + Intergenic
996589186 5:125126963-125126985 CAGGACCAGGCCTGTTTGGGAGG - Intergenic
996730739 5:126715221-126715243 CAGTCTCAGGAGTCTATGGGAGG + Intergenic
997368874 5:133343370-133343392 CAGCATCTGGGCTCCCTGGGAGG + Intronic
997523983 5:134540870-134540892 AAGGATCAGGCCTGCCTGGGAGG + Intronic
998055248 5:139070289-139070311 CAGAATCAGGACTCTCGGTGTGG + Intronic
998348625 5:141486247-141486269 CAGGTTCTGCACTCTCGGGGAGG - Exonic
998855496 5:146391017-146391039 CAGGATAAAGACACTCTGAGAGG + Intergenic
1000281873 5:159789201-159789223 CAGGGTCAGGAGGCTATGGGAGG + Intergenic
1002189132 5:177469787-177469809 CAGGCTGAGGACCCTCTGGGAGG + Intronic
1004576005 6:16895590-16895612 TATGATCAGGACTCTTTTGGGGG + Intergenic
1005494173 6:26374514-26374536 CAGGATCAGGAGTTTCTCAGAGG - Intronic
1005503410 6:26449849-26449871 CAGGGTCAGGAGTCTCTCAGAGG - Intronic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006452580 6:34113674-34113696 GAGGCTGACGACTCTCTGGGAGG + Intronic
1012402913 6:98859155-98859177 CTGGAGCAGGGTTCTCTGGGAGG - Intergenic
1012975795 6:105779779-105779801 CAGGAGCAGGACTGGCAGGGAGG + Intergenic
1015547960 6:134381209-134381231 CAGGCTCAGCACTCTTTTGGAGG - Intergenic
1016064069 6:139661034-139661056 CAGGATCAAGACTTTCAGGGAGG + Intergenic
1022491976 7:30827637-30827659 GAGGATGAGGACTGCCTGGGAGG + Intronic
1023187462 7:37547254-37547276 CAGGCTCAGGATCCTCTGAGAGG - Intergenic
1023325046 7:39045244-39045266 CAGCTTCAGGACCCACTGGGTGG + Intronic
1023830619 7:44036986-44037008 GAGGACCTGGCCTCTCTGGGGGG + Intergenic
1025812578 7:64884568-64884590 GAGAAGCAGGACTCCCTGGGGGG + Intronic
1027876978 7:83783202-83783224 GGGAATCAGGACTCTCTTGGTGG + Intergenic
1029740948 7:102491300-102491322 GAGGACCTGGCCTCTCTGGGGGG + Intronic
1029758942 7:102590473-102590495 GAGGACCTGGCCTCTCTGGGGGG + Intronic
1030124073 7:106138061-106138083 GAGTATCAGGACTCTCTCGTTGG + Intergenic
1032784375 7:135188765-135188787 GAGGCTCAGGAGTCCCTGGGGGG + Intronic
1035343017 7:158176618-158176640 CAGGGACAGGACTGTCTGGGAGG + Intronic
1037882507 8:22579876-22579898 CAGCATCAGGAATCTGGGGGTGG + Intronic
1041328172 8:56692159-56692181 CAGGAAAAGGGCTCTCTGTGTGG + Intergenic
1045305223 8:100951962-100951984 CGGGCTCAGCAGTCTCTGGGCGG + Exonic
1049324206 8:142013562-142013584 CTGGATCAGGAGACTGTGGGAGG + Intergenic
1049362274 8:142217851-142217873 CAGGATCAGGGCTCAGTGTGTGG + Intronic
1049362296 8:142217995-142218017 CAGGATCAGGGCTCAGTGTGTGG + Intronic
1049748011 8:144271111-144271133 CAGCATCAGGGCTCTCCTGGGGG + Intronic
1049778414 8:144416653-144416675 CTGGATCAAGAGGCTCTGGGCGG - Exonic
1051961236 9:22765214-22765236 CAGGATCAGGACTTGCTAGATGG + Intergenic
1052254423 9:26437486-26437508 GAGGAGAAGGGCTCTCTGGGAGG + Intergenic
1056878227 9:90359576-90359598 CAGGATCAGGGATGGCTGGGAGG - Intergenic
1060544782 9:124453454-124453476 CAGGATCAGGACTCTCTGGGCGG + Exonic
1186074610 X:5864561-5864583 AAGACTCAGAACTCTCTGGGAGG + Intronic
1188834869 X:34943644-34943666 CAGTATCAGGAGGCTCTGGGTGG - Exonic
1189007429 X:37010048-37010070 CAGTCTCAGGAGGCTCTGGGCGG - Exonic
1189007481 X:37010264-37010286 CAGTCTCAGGAGGCTCTGGGCGG - Exonic
1189007533 X:37010480-37010502 CAGTCTCAGGAGGCTCTGGGCGG - Exonic
1189041039 X:37542551-37542573 CAGTCTCAGGAGGCTCTGGGTGG + Intronic
1189245725 X:39561767-39561789 GCGCATCAGGCCTCTCTGGGAGG + Intergenic
1189810842 X:44779406-44779428 CAGGTTCATTCCTCTCTGGGTGG - Intergenic
1198821211 X:140650468-140650490 CAGGCTCAGGGCTGTTTGGGAGG - Intergenic
1198837462 X:140819941-140819963 CAGGATCACAGTTCTCTGGGGGG - Intergenic
1199947823 X:152681910-152681932 CAGGATCAGTGGTCTCAGGGAGG + Intergenic
1199961856 X:152786544-152786566 CAGGATCAGTGGTCTCAGGGAGG - Intergenic