ID: 1060547373

View in Genome Browser
Species Human (GRCh38)
Location 9:124469263-124469285
Sequence CCCCATGACTACGTGGCCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060547368_1060547373 -10 Left 1060547368 9:124469250-124469272 CCTGGCCATGCTCCCCCATGACT 0: 1
1: 0
2: 0
3: 22
4: 214
Right 1060547373 9:124469263-124469285 CCCCATGACTACGTGGCCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 118
1060547361_1060547373 23 Left 1060547361 9:124469217-124469239 CCCAGGCGTGCCTGTGGGCATCG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1060547373 9:124469263-124469285 CCCCATGACTACGTGGCCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 118
1060547357_1060547373 29 Left 1060547357 9:124469211-124469233 CCCTCTCCCAGGCGTGCCTGTGG 0: 1
1: 0
2: 2
3: 18
4: 255
Right 1060547373 9:124469263-124469285 CCCCATGACTACGTGGCCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 118
1060547365_1060547373 13 Left 1060547365 9:124469227-124469249 CCTGTGGGCATCGTGGCGGTCAC 0: 1
1: 0
2: 0
3: 0
4: 64
Right 1060547373 9:124469263-124469285 CCCCATGACTACGTGGCCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 118
1060547359_1060547373 28 Left 1060547359 9:124469212-124469234 CCTCTCCCAGGCGTGCCTGTGGG 0: 1
1: 0
2: 0
3: 30
4: 243
Right 1060547373 9:124469263-124469285 CCCCATGACTACGTGGCCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 118
1060547362_1060547373 22 Left 1060547362 9:124469218-124469240 CCAGGCGTGCCTGTGGGCATCGT 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1060547373 9:124469263-124469285 CCCCATGACTACGTGGCCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 118
1060547367_1060547373 -9 Left 1060547367 9:124469249-124469271 CCCTGGCCATGCTCCCCCATGAC 0: 1
1: 0
2: 0
3: 23
4: 228
Right 1060547373 9:124469263-124469285 CCCCATGACTACGTGGCCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060547373 Original CRISPR CCCCATGACTACGTGGCCCC CGG Exonic
900497834 1:2984310-2984332 CCCCTTGACTTCATGGCCTCTGG - Intergenic
900650272 1:3727006-3727028 CCCCCTGCCTACGTGGAGCCAGG + Intronic
902383835 1:16065277-16065299 CCGGTTGACTGCGTGGCCCCGGG - Intronic
905294782 1:36947307-36947329 CCCCATCACTACCTGCACCCAGG + Intronic
905595778 1:39205305-39205327 CCCCATCCCAAAGTGGCCCCAGG - Intronic
915535161 1:156530954-156530976 CCCCATGACTCTGTAGCCCGAGG + Intronic
1064772564 10:18738495-18738517 CCCCATGACCACTTTGTCCCTGG - Intergenic
1066047552 10:31606479-31606501 CCCCAGGACCACCTGGACCCAGG - Intergenic
1066457071 10:35581684-35581706 CACCATGAGAAGGTGGCCCCTGG - Intergenic
1067107954 10:43378005-43378027 CTCCACCACGACGTGGCCCCAGG - Intergenic
1067849183 10:49744192-49744214 CCCCAGGACTGAGTGGCCCATGG + Intronic
1075864193 10:125703838-125703860 GCCCCTGATTATGTGGCCCCTGG + Intergenic
1076725530 10:132411221-132411243 TCTCATGACCACGTCGCCCCAGG + Intronic
1079539962 11:21561313-21561335 CCTCCTAACTAGGTGGCCCCAGG - Intronic
1079893565 11:26090076-26090098 CTGCATGACTATGTGACCCCTGG - Intergenic
1085694463 11:78692119-78692141 CCCCATGATTAGGTGGCATCTGG + Intronic
1093852194 12:24054263-24054285 CCCCTTCACTAACTGGCCCCAGG + Intergenic
1104424216 12:128661387-128661409 CCCCATGATTACGTATCCCTTGG - Intronic
1104820038 12:131671900-131671922 CCCCATGACCACCTGAGCCCTGG + Intergenic
1105474309 13:20717734-20717756 CCCCATGGCTGCGTGGGCCATGG - Intronic
1113672776 13:112186183-112186205 GCCCATTCCTGCGTGGCCCCAGG + Intergenic
1114076509 14:19164210-19164232 CCTCATGTCTACCTGGGCCCTGG + Intergenic
1114085654 14:19235358-19235380 CCTCATGTCTACCTGGGCCCTGG - Intergenic
1118747024 14:68781645-68781667 CTCCATGACTATGGGTCCCCAGG + Intergenic
1119138637 14:72244588-72244610 CCCTGTGACTAAGTGGCTCCTGG - Intronic
1121314978 14:92955777-92955799 CCCCATCCCTGCGTGGCCACGGG + Intronic
1122542555 14:102506291-102506313 CCCCATGACTAATGGGCACCAGG - Exonic
1122716828 14:103701040-103701062 CCCCATGACCCCTCGGCCCCAGG + Intronic
1202897210 14_GL000194v1_random:17072-17094 CCTCATGTCTACCTGGGCCCTGG - Intergenic
1129248299 15:74293331-74293353 CCCATTGACCAGGTGGCCCCTGG - Intronic
1129656276 15:77527437-77527459 CCCCAGGACCTCGAGGCCCCGGG - Intergenic
1130130152 15:81134248-81134270 CGCCATGACGACCCGGCCCCAGG - Exonic
1131365791 15:91838120-91838142 CCAGATGACTTCTTGGCCCCTGG + Intergenic
1134102082 16:11459723-11459745 CCCCATGACCCCATGTCCCCAGG - Intronic
1141113797 16:81291517-81291539 CCCCATCACTACCTGGCTCAGGG - Intergenic
1141309522 16:82899867-82899889 GCCCATGATTTCCTGGCCCCTGG + Intronic
1142229612 16:88893721-88893743 CCCCATGTCTGCCAGGCCCCTGG - Intronic
1142964053 17:3569907-3569929 CTCCCTGACCACTTGGCCCCTGG - Intronic
1148907287 17:50919490-50919512 CCCCGTGACTGCTGGGCCCCTGG - Intergenic
1149439283 17:56661699-56661721 CACCATGGCGACATGGCCCCTGG + Intergenic
1151713251 17:75818500-75818522 CCCCATGCCCACATGGGCCCCGG - Intronic
1152699607 17:81812444-81812466 CCCCAGGGCTATGTGGCCCAGGG + Intronic
1157152867 18:45236947-45236969 CCCCAAGACTTCCAGGCCCCAGG - Intronic
1159054708 18:63452227-63452249 CCCCATGCCTATGTGTTCCCAGG - Intergenic
1160513724 18:79466980-79467002 CCCCTTGCCCAGGTGGCCCCGGG + Intronic
1160527032 18:79544238-79544260 CCACAGGACAACGTGGCCCGCGG - Intergenic
1162206408 19:9059445-9059467 CACAATGACTAGGTGGCTCCAGG + Intergenic
1163586995 19:18169545-18169567 CCCCATATCTACGTGTCCTCCGG + Exonic
1165092976 19:33396321-33396343 CCCCCTGACCACGGGGCCACAGG + Intronic
1166039329 19:40192245-40192267 CCCAGCAACTACGTGGCCCCCGG + Exonic
1166745952 19:45141967-45141989 CCCCAGCACTCCCTGGCCCCAGG - Intronic
1166745963 19:45141994-45142016 CCCCAGCACTCCCTGGCCCCAGG - Intronic
925395611 2:3531485-3531507 CCCCATGATTGCGTGAGCCCAGG + Intergenic
929805434 2:45140789-45140811 CCCCAAGACTACTTCCCCCCAGG - Intergenic
935608128 2:104991091-104991113 CCCCAGGACTACTAGGTCCCAGG - Intergenic
938491103 2:131761726-131761748 CCTCATGTCTACCTGGGCCCTGG + Intronic
938496461 2:131800611-131800633 CCTCATGTCTACCTGGGCCCTGG - Intronic
939498428 2:142950594-142950616 CCCCATGATTACGTCCCGCCAGG + Intronic
941570920 2:167169333-167169355 TCCTATGACTGCGTGGCCCTGGG + Intronic
946861115 2:224001227-224001249 CTCCATCACTACGAGGCCCCTGG + Intronic
947711927 2:232321431-232321453 CCACATGACATCATGGCCCCTGG - Intronic
1172382463 20:34506729-34506751 CCCCATGACTCCCTTTCCCCAGG + Intronic
1174167770 20:48597633-48597655 CCCCAGGTCCACGTGGCCCAAGG + Intergenic
1176616894 21:9033061-9033083 CCTCATGTCTACCTGGGCCCTGG - Intergenic
1176708239 21:10130586-10130608 CCTCATGTCTACCTGGGCCCTGG + Intergenic
1177946389 21:27475192-27475214 CCCCATGACTACCTGGTATCTGG + Intergenic
1180292319 22:10857835-10857857 CCTCATGTCTACCTGGGCCCTGG + Intergenic
1180455850 22:15512238-15512260 CCTCATGTCTACCTGGGCCCTGG + Intergenic
1180495125 22:15887257-15887279 CCTCATGTCTACCTGGGCCCTGG + Intergenic
1180786952 22:18552816-18552838 CCCCTGGCCTAGGTGGCCCCTGG - Intergenic
1181224417 22:21383152-21383174 CCCCATGCCTATCTGGCCCTGGG + Intergenic
1181234788 22:21442490-21442512 CCCCTGGCCTAGGTGGCCCCTGG + Exonic
1181243862 22:21492341-21492363 CCCCTGGCCTAGGTGGCCCCTGG - Intergenic
1181254215 22:21551661-21551683 CCCCATGCCTATCTGGCCCTGGG - Intronic
1181577300 22:23803112-23803134 CCCCATTAGACCGTGGCCCCGGG + Intronic
1182826805 22:33272754-33272776 CCACATGACTACCAGGCCCAAGG + Intronic
1183628838 22:39021077-39021099 GGCCATGACTACGAGGCCCTGGG + Intronic
1183632314 22:39040836-39040858 GGCCATGACTACGAGGCCCTGGG + Exonic
1183638136 22:39077237-39077259 GGCCATGACTACGAGGCCCTGGG + Exonic
1184093596 22:42304934-42304956 CCCCAAGAGTACGGGGCCCCTGG - Intronic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184289149 22:43489088-43489110 CCCGAAGTCCACGTGGCCCCTGG - Intronic
952218948 3:31304878-31304900 CCCAATGACTACCTGGACACTGG + Intergenic
952269799 3:31819538-31819560 CCTCACTCCTACGTGGCCCCTGG - Intronic
952826866 3:37531561-37531583 CTCCCTGACGAGGTGGCCCCTGG + Intronic
953869988 3:46618127-46618149 GCCCATGACTCCATGGCCACTGG + Intronic
954124235 3:48519271-48519293 CCCCATGAAGACCTGGCCTCTGG + Exonic
954223371 3:49167742-49167764 CCCCATGAGATCCTGGCCCCTGG - Intergenic
961359057 3:126356273-126356295 CCCCCGGACCAGGTGGCCCCTGG - Intronic
968654335 4:1772119-1772141 ACCCATGAATACATGGCCCCTGG + Intergenic
968703475 4:2067385-2067407 CCCCAGGACCTCGTGGCCTCAGG - Exonic
991992985 5:72359884-72359906 CCCCATTACTGTGTGGCCCTGGG + Intronic
994616563 5:102111653-102111675 CCCCATGACAAAGTGGGCCAGGG - Intergenic
996835913 5:127792231-127792253 CAACATGACTACGAGGCCTCAGG + Intergenic
998152208 5:139763992-139764014 CACCCTGACTACATGGCCTCTGG + Intergenic
1001335890 5:170796127-170796149 CCCCATGAATATTTGGCTCCTGG - Intronic
1001912335 5:175531344-175531366 CCCAATGACCACATGGCCCCCGG - Intergenic
1002481778 5:179506146-179506168 CCCAATGCCTTCGTGGCCCTGGG + Intergenic
1008660343 6:53661289-53661311 CCCCATGACAACATAGCCTCTGG - Intronic
1013462257 6:110386500-110386522 CCCCAGCAGTACGTGGGCCCTGG + Intergenic
1018625365 6:165772506-165772528 CCCCATGGCAACGCGGGCCCTGG - Intronic
1020138169 7:5598097-5598119 CCTGATGTCTACGTGGCACCAGG + Intronic
1023859041 7:44206090-44206112 ACCCTTGACAACATGGCCCCAGG - Intronic
1024672908 7:51612797-51612819 CCCCAGTACAAAGTGGCCCCTGG - Intergenic
1025281316 7:57627924-57627946 CCAGATGTCTACGAGGCCCCAGG - Intergenic
1025303413 7:57837583-57837605 CCAGATGTCTACGAGGCCCCAGG + Intergenic
1034101462 7:148454237-148454259 CCACATGACTACTTGGAGCCAGG - Intergenic
1034806247 7:154091711-154091733 CCCCCTCACCACGTGGCCTCAGG + Intronic
1038950313 8:32407024-32407046 ACCCATGACTTTGTGACCCCAGG - Intronic
1042532236 8:69828020-69828042 CCCCATGACTTTCTGACCCCAGG - Intronic
1049014507 8:139910114-139910136 CCCCAGGCCCAGGTGGCCCCTGG + Intronic
1053645201 9:40116100-40116122 CCTCATGTCTACCTGGGCCCTGG + Intergenic
1053760515 9:41347428-41347450 CCTCATGTCTACCTGGGCCCTGG - Intergenic
1054326224 9:63713998-63714020 CCTCATGTCTACCTGGGCCCTGG + Intergenic
1054539370 9:66259871-66259893 CCTCATGTCTACCTGGGCCCTGG - Intergenic
1060516279 9:124267751-124267773 CCACATGCCTTCTTGGCCCCTGG + Intronic
1060547373 9:124469263-124469285 CCCCATGACTACGTGGCCCCCGG + Exonic
1061471612 9:130831219-130831241 CCCCAGGACAAGGTGACCCCAGG - Intronic
1061571123 9:131477993-131478015 CCCGAGGACTGCATGGCCCCTGG - Intronic
1062392063 9:136337810-136337832 CGCCATGACCACCTGGCCTCCGG + Intronic
1202793000 9_KI270719v1_random:99555-99577 CCTCATGTCTACCTGGGCCCTGG + Intergenic
1198686776 X:139235810-139235832 CACCATGACTATGTGACCCTAGG + Intergenic
1201503745 Y:14674759-14674781 CTCCATGACCACATGGCACCTGG - Intronic