ID: 1060547805 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:124471076-124471098 |
Sequence | CCCGGGCTTCCCGGGTCTCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1060547796_1060547805 | 3 | Left | 1060547796 | 9:124471050-124471072 | CCAGTTCATGAGGCCACAGGAAA | No data | ||
Right | 1060547805 | 9:124471076-124471098 | CCCGGGCTTCCCGGGTCTCTTGG | No data | ||||
1060547801_1060547805 | -10 | Left | 1060547801 | 9:124471063-124471085 | CCACAGGAAAGGGCCCGGGCTTC | No data | ||
Right | 1060547805 | 9:124471076-124471098 | CCCGGGCTTCCCGGGTCTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1060547805 | Original CRISPR | CCCGGGCTTCCCGGGTCTCT TGG | Intronic | ||