ID: 1060547805

View in Genome Browser
Species Human (GRCh38)
Location 9:124471076-124471098
Sequence CCCGGGCTTCCCGGGTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060547796_1060547805 3 Left 1060547796 9:124471050-124471072 CCAGTTCATGAGGCCACAGGAAA No data
Right 1060547805 9:124471076-124471098 CCCGGGCTTCCCGGGTCTCTTGG No data
1060547801_1060547805 -10 Left 1060547801 9:124471063-124471085 CCACAGGAAAGGGCCCGGGCTTC No data
Right 1060547805 9:124471076-124471098 CCCGGGCTTCCCGGGTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060547805 Original CRISPR CCCGGGCTTCCCGGGTCTCT TGG Intronic