ID: 1060548668

View in Genome Browser
Species Human (GRCh38)
Location 9:124475236-124475258
Sequence AGCAGGCCAGGGGACCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 365}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060548668_1060548679 15 Left 1060548668 9:124475236-124475258 CCCTTCTGGTCCCCTGGCCTGCT 0: 1
1: 0
2: 1
3: 42
4: 365
Right 1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1060548668_1060548683 20 Left 1060548668 9:124475236-124475258 CCCTTCTGGTCCCCTGGCCTGCT 0: 1
1: 0
2: 1
3: 42
4: 365
Right 1060548683 9:124475279-124475301 CGCAGGCGGGCACGAGGGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 203
1060548668_1060548677 7 Left 1060548668 9:124475236-124475258 CCCTTCTGGTCCCCTGGCCTGCT 0: 1
1: 0
2: 1
3: 42
4: 365
Right 1060548677 9:124475266-124475288 ACAGCTACTCCTCCGCAGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 120
1060548668_1060548674 3 Left 1060548668 9:124475236-124475258 CCCTTCTGGTCCCCTGGCCTGCT 0: 1
1: 0
2: 1
3: 42
4: 365
Right 1060548674 9:124475262-124475284 TGCCACAGCTACTCCTCCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 99
1060548668_1060548678 14 Left 1060548668 9:124475236-124475258 CCCTTCTGGTCCCCTGGCCTGCT 0: 1
1: 0
2: 1
3: 42
4: 365
Right 1060548678 9:124475273-124475295 CTCCTCCGCAGGCGGGCACGAGG 0: 1
1: 0
2: 0
3: 7
4: 104
1060548668_1060548682 19 Left 1060548668 9:124475236-124475258 CCCTTCTGGTCCCCTGGCCTGCT 0: 1
1: 0
2: 1
3: 42
4: 365
Right 1060548682 9:124475278-124475300 CCGCAGGCGGGCACGAGGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 279
1060548668_1060548676 6 Left 1060548668 9:124475236-124475258 CCCTTCTGGTCCCCTGGCCTGCT 0: 1
1: 0
2: 1
3: 42
4: 365
Right 1060548676 9:124475265-124475287 CACAGCTACTCCTCCGCAGGCGG 0: 1
1: 0
2: 0
3: 16
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060548668 Original CRISPR AGCAGGCCAGGGGACCAGAA GGG (reversed) Intronic