ID: 1060548669

View in Genome Browser
Species Human (GRCh38)
Location 9:124475237-124475259
Sequence TAGCAGGCCAGGGGACCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 273}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060548669_1060548674 2 Left 1060548669 9:124475237-124475259 CCTTCTGGTCCCCTGGCCTGCTA 0: 1
1: 0
2: 1
3: 22
4: 273
Right 1060548674 9:124475262-124475284 TGCCACAGCTACTCCTCCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 99
1060548669_1060548679 14 Left 1060548669 9:124475237-124475259 CCTTCTGGTCCCCTGGCCTGCTA 0: 1
1: 0
2: 1
3: 22
4: 273
Right 1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1060548669_1060548676 5 Left 1060548669 9:124475237-124475259 CCTTCTGGTCCCCTGGCCTGCTA 0: 1
1: 0
2: 1
3: 22
4: 273
Right 1060548676 9:124475265-124475287 CACAGCTACTCCTCCGCAGGCGG 0: 1
1: 0
2: 0
3: 16
4: 89
1060548669_1060548677 6 Left 1060548669 9:124475237-124475259 CCTTCTGGTCCCCTGGCCTGCTA 0: 1
1: 0
2: 1
3: 22
4: 273
Right 1060548677 9:124475266-124475288 ACAGCTACTCCTCCGCAGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 120
1060548669_1060548683 19 Left 1060548669 9:124475237-124475259 CCTTCTGGTCCCCTGGCCTGCTA 0: 1
1: 0
2: 1
3: 22
4: 273
Right 1060548683 9:124475279-124475301 CGCAGGCGGGCACGAGGGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 203
1060548669_1060548682 18 Left 1060548669 9:124475237-124475259 CCTTCTGGTCCCCTGGCCTGCTA 0: 1
1: 0
2: 1
3: 22
4: 273
Right 1060548682 9:124475278-124475300 CCGCAGGCGGGCACGAGGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 279
1060548669_1060548678 13 Left 1060548669 9:124475237-124475259 CCTTCTGGTCCCCTGGCCTGCTA 0: 1
1: 0
2: 1
3: 22
4: 273
Right 1060548678 9:124475273-124475295 CTCCTCCGCAGGCGGGCACGAGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060548669 Original CRISPR TAGCAGGCCAGGGGACCAGA AGG (reversed) Intronic