ID: 1060548672

View in Genome Browser
Species Human (GRCh38)
Location 9:124475248-124475270
Sequence GCTGTGGCATTTAGCAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 151}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060548672_1060548679 3 Left 1060548672 9:124475248-124475270 CCTGGCCTGCTAAATGCCACAGC 0: 1
1: 0
2: 0
3: 7
4: 151
Right 1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1060548672_1060548677 -5 Left 1060548672 9:124475248-124475270 CCTGGCCTGCTAAATGCCACAGC 0: 1
1: 0
2: 0
3: 7
4: 151
Right 1060548677 9:124475266-124475288 ACAGCTACTCCTCCGCAGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 120
1060548672_1060548676 -6 Left 1060548672 9:124475248-124475270 CCTGGCCTGCTAAATGCCACAGC 0: 1
1: 0
2: 0
3: 7
4: 151
Right 1060548676 9:124475265-124475287 CACAGCTACTCCTCCGCAGGCGG 0: 1
1: 0
2: 0
3: 16
4: 89
1060548672_1060548678 2 Left 1060548672 9:124475248-124475270 CCTGGCCTGCTAAATGCCACAGC 0: 1
1: 0
2: 0
3: 7
4: 151
Right 1060548678 9:124475273-124475295 CTCCTCCGCAGGCGGGCACGAGG 0: 1
1: 0
2: 0
3: 7
4: 104
1060548672_1060548683 8 Left 1060548672 9:124475248-124475270 CCTGGCCTGCTAAATGCCACAGC 0: 1
1: 0
2: 0
3: 7
4: 151
Right 1060548683 9:124475279-124475301 CGCAGGCGGGCACGAGGGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 203
1060548672_1060548682 7 Left 1060548672 9:124475248-124475270 CCTGGCCTGCTAAATGCCACAGC 0: 1
1: 0
2: 0
3: 7
4: 151
Right 1060548682 9:124475278-124475300 CCGCAGGCGGGCACGAGGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 279
1060548672_1060548674 -9 Left 1060548672 9:124475248-124475270 CCTGGCCTGCTAAATGCCACAGC 0: 1
1: 0
2: 0
3: 7
4: 151
Right 1060548674 9:124475262-124475284 TGCCACAGCTACTCCTCCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060548672 Original CRISPR GCTGTGGCATTTAGCAGGCC AGG (reversed) Intronic