ID: 1060548679

View in Genome Browser
Species Human (GRCh38)
Location 9:124475274-124475296
Sequence TCCTCCGCAGGCGGGCACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060548667_1060548679 16 Left 1060548667 9:124475235-124475257 CCCCTTCTGGTCCCCTGGCCTGC 0: 1
1: 0
2: 4
3: 42
4: 365
Right 1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1060548669_1060548679 14 Left 1060548669 9:124475237-124475259 CCTTCTGGTCCCCTGGCCTGCTA 0: 1
1: 0
2: 1
3: 22
4: 273
Right 1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1060548670_1060548679 5 Left 1060548670 9:124475246-124475268 CCCCTGGCCTGCTAAATGCCACA 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1060548668_1060548679 15 Left 1060548668 9:124475236-124475258 CCCTTCTGGTCCCCTGGCCTGCT 0: 1
1: 0
2: 1
3: 42
4: 365
Right 1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1060548671_1060548679 4 Left 1060548671 9:124475247-124475269 CCCTGGCCTGCTAAATGCCACAG 0: 1
1: 0
2: 0
3: 21
4: 175
Right 1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1060548673_1060548679 -2 Left 1060548673 9:124475253-124475275 CCTGCTAAATGCCACAGCTACTC 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1060548672_1060548679 3 Left 1060548672 9:124475248-124475270 CCTGGCCTGCTAAATGCCACAGC 0: 1
1: 0
2: 0
3: 7
4: 151
Right 1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060548679 Original CRISPR TCCTCCGCAGGCGGGCACGA GGG Intronic
903034465 1:20485417-20485439 TCCGCCGCGGGCGGGGACGCGGG - Exonic
919981560 1:202645183-202645205 TGCTCAGCAGGAGGGCACCAGGG + Intronic
924451273 1:244181331-244181353 TCCTCCGCAGGGAGGAACGCAGG - Intergenic
1064859831 10:19815779-19815801 CCCCCCGCAGTCGGGCGCGAAGG + Intergenic
1071564942 10:86666926-86666948 TCCTCCCCAGCCTGGCAGGATGG + Intergenic
1083272915 11:61580993-61581015 TGCTCCGCGGGCGGGCGGGAGGG - Intronic
1083351315 11:62031027-62031049 TGCTCCCCAGCCGGGCACGGTGG - Intergenic
1084275635 11:68049749-68049771 TCCTCCGCAGGCGGCGGCGGTGG - Exonic
1090365423 11:126201311-126201333 TGTTCCCCAGGCGGGCACGTTGG - Intergenic
1096083585 12:48849857-48849879 TCCTCCCCAGGCAGGAGCGAAGG - Intronic
1100807960 12:98307435-98307457 TCCTCAGCAGCCGGGACCGAGGG - Intergenic
1104877287 12:132044335-132044357 CCCTCAGCAGGGGGGCAAGAGGG - Intronic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1112374476 13:98825881-98825903 TCCTCCTCAGGCAGGCGCTATGG + Exonic
1113568842 13:111339144-111339166 GCCTCCCCAGGTGGCCACGAGGG - Intronic
1114153465 14:20072124-20072146 TCATCCCCAGCCGGGCACGGTGG - Intergenic
1123783560 15:23647445-23647467 TCCCCCGCTGGGGGGCCCGATGG - Exonic
1124497247 15:30193919-30193941 TGCTCAGCAGGAGGGCACCAGGG + Intergenic
1124746327 15:32344728-32344750 TGCTCAGCAGGAGGGCACCAGGG - Intergenic
1126761168 15:51971519-51971541 TCCTCCTCCGGCGGGCAGGATGG - Intronic
1129878584 15:78992849-78992871 TCCTCCACAGACGGGCACTGAGG + Intronic
1133098111 16:3461339-3461361 ACCTCCGCAGGGGGGCACTCTGG - Intronic
1137492343 16:48943714-48943736 TCCTCAGCAGGAGGGCTCCAAGG + Intergenic
1147258462 17:39195715-39195737 TCCTCCCCAAGGGGGCAAGAGGG + Intronic
1152540417 17:80971804-80971826 TCCACCGCAGGCGAGCTGGAGGG + Intergenic
1152904176 17:82961370-82961392 TTCTCCACAGGCGGGAAAGAGGG + Intronic
1153636483 18:7117607-7117629 TCCCCCGCAGGCGGGCGGGCGGG - Intronic
1156858120 18:41806470-41806492 TCCTCACCAGCCGGGCAAGATGG + Intergenic
1160816327 19:1037615-1037637 TCCTCTCCAGGTGGGCATGACGG + Exonic
1161589816 19:5124281-5124303 TCCTCCCCAGGCCGGCGCGGTGG + Intronic
1162300060 19:9839510-9839532 TCCTCTGCAGTCTGGCACCAAGG + Intronic
1164526946 19:29019679-29019701 CCATCCGCAGGCGGTCACCAAGG - Intergenic
1167463881 19:49640118-49640140 TCCCCCGCAGGCGGTAGCGAAGG - Exonic
925922229 2:8645588-8645610 TCCTCCCCAGGCGGGCGGGCGGG - Intergenic
931068944 2:58622520-58622542 TCCTCCCCAGCTGGGCACGGTGG + Intergenic
1174368836 20:50072829-50072851 CCTTCGGCAGGCGGGCACGGTGG - Intergenic
1174620026 20:51866983-51867005 TACTCAGCAGCCGGGCACGGTGG + Intergenic
1176219799 20:63964510-63964532 TCCTCCTCAGGCGGGGACGCAGG + Exonic
1179642508 21:42756803-42756825 TCAGCCCCGGGCGGGCACGAGGG - Intronic
1179934460 21:44593242-44593264 GCCACCCCAGGCGGGGACGAGGG - Intronic
1182358156 22:29731598-29731620 TCCCCCACAGGTGGACACGAAGG - Exonic
1184864057 22:47192779-47192801 TCCGGGGCAGGCGGGCAAGAGGG - Intergenic
950163145 3:10774826-10774848 TCCTCCTGAGGCAGGAACGAAGG + Intergenic
960907995 3:122620781-122620803 TGCTCCTCAGGAGGGCAGGATGG + Intronic
961657282 3:128450116-128450138 TCCTCCCCAGCCGGGCATTAAGG + Intergenic
968593878 4:1472699-1472721 TCCTCCTCAGGTGGCCACGCCGG + Intergenic
968642639 4:1722041-1722063 TCCGCCGCAGGCGGCCTAGATGG - Intronic
982268900 4:153566929-153566951 TCCCTGGCAGGCGGGCACGAGGG - Intronic
985778491 5:1857459-1857481 TCCCCCGAAGGCGGGGACGTCGG + Intergenic
995462575 5:112419325-112419347 TCCTCCGAAGGCGGGGGCGCGGG + Intergenic
1001723164 5:173873172-173873194 ACCTCAGCAGGCTGGCACCAGGG - Intergenic
1006316566 6:33295261-33295283 TCCTCAGAAGGCGGGGAAGAGGG - Intronic
1011640446 6:89412200-89412222 TCCTCCGCCGGCGGGCGGGGCGG - Exonic
1018909766 6:168095296-168095318 TCTTCCGCCGACGGGCACAACGG + Intergenic
1019344722 7:523629-523651 TCCTGGGCAGGTGGGCAGGAGGG - Intergenic
1019891339 7:3949496-3949518 TCCTCCGCTGCCGCTCACGATGG + Intronic
1032680983 7:134183041-134183063 TCTCCCGCAGCCGGGCGCGATGG - Intronic
1032841176 7:135714609-135714631 TCCTCTGCATGCGGGCCCGTGGG - Intronic
1036259304 8:7227888-7227910 CCCGCCGCTGCCGGGCACGAAGG - Intergenic
1036311346 8:7686458-7686480 CCCGCCGCTGCCGGGCACGAAGG - Intergenic
1049039077 8:140098888-140098910 TCCTCCGCAGCCGTGCACAGGGG + Intronic
1057460206 9:95254272-95254294 ACCTCCACAGGCTGGCAAGATGG + Intronic
1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG + Intronic
1061128383 9:128690259-128690281 TTCTCCGCACGCTGGCGCGACGG - Intronic
1062196233 9:135275703-135275725 TCCTCCTCAGGCCTGCAGGAAGG - Intergenic
1201145140 Y:11060422-11060444 TCCTCCCCAGCCGGGCACTGTGG - Intergenic