ID: 1060548679

View in Genome Browser
Species Human (GRCh38)
Location 9:124475274-124475296
Sequence TCCTCCGCAGGCGGGCACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060548668_1060548679 15 Left 1060548668 9:124475236-124475258 CCCTTCTGGTCCCCTGGCCTGCT 0: 1
1: 0
2: 1
3: 42
4: 365
Right 1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1060548669_1060548679 14 Left 1060548669 9:124475237-124475259 CCTTCTGGTCCCCTGGCCTGCTA 0: 1
1: 0
2: 1
3: 22
4: 273
Right 1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1060548672_1060548679 3 Left 1060548672 9:124475248-124475270 CCTGGCCTGCTAAATGCCACAGC 0: 1
1: 0
2: 0
3: 7
4: 151
Right 1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1060548673_1060548679 -2 Left 1060548673 9:124475253-124475275 CCTGCTAAATGCCACAGCTACTC 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1060548671_1060548679 4 Left 1060548671 9:124475247-124475269 CCCTGGCCTGCTAAATGCCACAG 0: 1
1: 0
2: 0
3: 21
4: 175
Right 1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1060548667_1060548679 16 Left 1060548667 9:124475235-124475257 CCCCTTCTGGTCCCCTGGCCTGC 0: 1
1: 0
2: 4
3: 42
4: 365
Right 1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1060548670_1060548679 5 Left 1060548670 9:124475246-124475268 CCCCTGGCCTGCTAAATGCCACA 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060548679 Original CRISPR TCCTCCGCAGGCGGGCACGA GGG Intronic