ID: 1060549744

View in Genome Browser
Species Human (GRCh38)
Location 9:124479300-124479322
Sequence GAAGCAGCCGAGACCCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060549742_1060549744 4 Left 1060549742 9:124479273-124479295 CCCGGGAGGTGGGGCAGGGCTGA No data
Right 1060549744 9:124479300-124479322 GAAGCAGCCGAGACCCAGTGAGG No data
1060549731_1060549744 23 Left 1060549731 9:124479254-124479276 CCAGGACCTCCAAGCAGCTCCCG No data
Right 1060549744 9:124479300-124479322 GAAGCAGCCGAGACCCAGTGAGG No data
1060549735_1060549744 17 Left 1060549735 9:124479260-124479282 CCTCCAAGCAGCTCCCGGGAGGT No data
Right 1060549744 9:124479300-124479322 GAAGCAGCCGAGACCCAGTGAGG No data
1060549743_1060549744 3 Left 1060549743 9:124479274-124479296 CCGGGAGGTGGGGCAGGGCTGAG No data
Right 1060549744 9:124479300-124479322 GAAGCAGCCGAGACCCAGTGAGG No data
1060549737_1060549744 14 Left 1060549737 9:124479263-124479285 CCAAGCAGCTCCCGGGAGGTGGG No data
Right 1060549744 9:124479300-124479322 GAAGCAGCCGAGACCCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060549744 Original CRISPR GAAGCAGCCGAGACCCAGTG AGG Intergenic
No off target data available for this crispr