ID: 1060549924

View in Genome Browser
Species Human (GRCh38)
Location 9:124480063-124480085
Sequence CAGTGTGAGCAGAAGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060549924_1060549936 29 Left 1060549924 9:124480063-124480085 CCTCCATCCTTCTGCTCACACTG No data
Right 1060549936 9:124480115-124480137 TATCTAGCTGGTGAACTCCTGGG No data
1060549924_1060549935 28 Left 1060549924 9:124480063-124480085 CCTCCATCCTTCTGCTCACACTG No data
Right 1060549935 9:124480114-124480136 CTATCTAGCTGGTGAACTCCTGG No data
1060549924_1060549930 17 Left 1060549924 9:124480063-124480085 CCTCCATCCTTCTGCTCACACTG No data
Right 1060549930 9:124480103-124480125 GTCCCCAGCTCCTATCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060549924 Original CRISPR CAGTGTGAGCAGAAGGATGG AGG (reversed) Intergenic
No off target data available for this crispr