ID: 1060549935

View in Genome Browser
Species Human (GRCh38)
Location 9:124480114-124480136
Sequence CTATCTAGCTGGTGAACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060549922_1060549935 30 Left 1060549922 9:124480061-124480083 CCCCTCCATCCTTCTGCTCACAC No data
Right 1060549935 9:124480114-124480136 CTATCTAGCTGGTGAACTCCTGG No data
1060549924_1060549935 28 Left 1060549924 9:124480063-124480085 CCTCCATCCTTCTGCTCACACTG No data
Right 1060549935 9:124480114-124480136 CTATCTAGCTGGTGAACTCCTGG No data
1060549927_1060549935 3 Left 1060549927 9:124480088-124480110 CCCTCTGCCTGAACTGTCCCCAG No data
Right 1060549935 9:124480114-124480136 CTATCTAGCTGGTGAACTCCTGG No data
1060549929_1060549935 -4 Left 1060549929 9:124480095-124480117 CCTGAACTGTCCCCAGCTCCTAT No data
Right 1060549935 9:124480114-124480136 CTATCTAGCTGGTGAACTCCTGG No data
1060549923_1060549935 29 Left 1060549923 9:124480062-124480084 CCCTCCATCCTTCTGCTCACACT No data
Right 1060549935 9:124480114-124480136 CTATCTAGCTGGTGAACTCCTGG No data
1060549928_1060549935 2 Left 1060549928 9:124480089-124480111 CCTCTGCCTGAACTGTCCCCAGC No data
Right 1060549935 9:124480114-124480136 CTATCTAGCTGGTGAACTCCTGG No data
1060549926_1060549935 21 Left 1060549926 9:124480070-124480092 CCTTCTGCTCACACTGTTCCCTC No data
Right 1060549935 9:124480114-124480136 CTATCTAGCTGGTGAACTCCTGG No data
1060549925_1060549935 25 Left 1060549925 9:124480066-124480088 CCATCCTTCTGCTCACACTGTTC No data
Right 1060549935 9:124480114-124480136 CTATCTAGCTGGTGAACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060549935 Original CRISPR CTATCTAGCTGGTGAACTCC TGG Intergenic
No off target data available for this crispr