ID: 1060551536

View in Genome Browser
Species Human (GRCh38)
Location 9:124487761-124487783
Sequence AGCTGGGGCTCCAGGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 532}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060551536_1060551545 -7 Left 1060551536 9:124487761-124487783 CCAGTTTCCCTGGAGCCCCAGCT 0: 1
1: 0
2: 2
3: 55
4: 532
Right 1060551545 9:124487777-124487799 CCCAGCTCTGGTGGTCTGGGTGG No data
1060551536_1060551550 27 Left 1060551536 9:124487761-124487783 CCAGTTTCCCTGGAGCCCCAGCT 0: 1
1: 0
2: 2
3: 55
4: 532
Right 1060551550 9:124487811-124487833 GAGACCTCTGCTCCAGACCCTGG No data
1060551536_1060551548 0 Left 1060551536 9:124487761-124487783 CCAGTTTCCCTGGAGCCCCAGCT 0: 1
1: 0
2: 2
3: 55
4: 532
Right 1060551548 9:124487784-124487806 CTGGTGGTCTGGGTGGGATCAGG No data
1060551536_1060551547 -6 Left 1060551536 9:124487761-124487783 CCAGTTTCCCTGGAGCCCCAGCT 0: 1
1: 0
2: 2
3: 55
4: 532
Right 1060551547 9:124487778-124487800 CCAGCTCTGGTGGTCTGGGTGGG No data
1060551536_1060551542 -10 Left 1060551536 9:124487761-124487783 CCAGTTTCCCTGGAGCCCCAGCT 0: 1
1: 0
2: 2
3: 55
4: 532
Right 1060551542 9:124487774-124487796 AGCCCCAGCTCTGGTGGTCTGGG No data
1060551536_1060551549 5 Left 1060551536 9:124487761-124487783 CCAGTTTCCCTGGAGCCCCAGCT 0: 1
1: 0
2: 2
3: 55
4: 532
Right 1060551549 9:124487789-124487811 GGTCTGGGTGGGATCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060551536 Original CRISPR AGCTGGGGCTCCAGGGAAAC TGG (reversed) Intronic
900165981 1:1244546-1244568 AGCTGGGACCCCAGGGCAGCGGG + Intronic
900179619 1:1305504-1305526 TGCTGGCTCTCCAGGGACACGGG - Intronic
900716618 1:4149062-4149084 AGCTCTGGCAACAGGGAAACAGG - Intergenic
900776926 1:4592617-4592639 AACTAGGCCTCCAGGGAAAGAGG + Intergenic
901305249 1:8228101-8228123 AGCTGTTGCTCCATGGACACAGG - Intergenic
901316691 1:8314751-8314773 AGCCAGGGCCCCAGGGAAGCAGG - Intergenic
901773462 1:11543141-11543163 AGCCAGGGCACCAGGGAAAGAGG + Intergenic
902321436 1:15669946-15669968 AGCTGGCACACCAGGGAAAGGGG + Intergenic
902509703 1:16959586-16959608 AGATGGGTTTCCAGTGAAACTGG + Intronic
903300794 1:22377229-22377251 TGCTGGAGCTCCTGGGAAAGAGG + Intergenic
903335284 1:22620402-22620424 AGAGGGGGCTCCAAGGAACCCGG + Intergenic
903702715 1:25262583-25262605 AGCTGGAGACCCAGGGATACTGG + Intronic
903711981 1:25332909-25332931 AGCTGGAGACCCAGGGATACTGG + Intronic
903890296 1:26565456-26565478 TGCGGGGGCTCCAGGAGAACTGG - Intronic
904008729 1:27377947-27377969 AGCAGGGGCTCTAGGGAGACGGG + Intergenic
904120893 1:28197077-28197099 CACTGGGGCCCCAGGGAAGCGGG + Intergenic
905028877 1:34868507-34868529 GGCTGGGGCTGCAGTGTAACAGG - Intronic
905229334 1:36504852-36504874 AGCTGGGACTACAGGGGCACAGG + Intergenic
905643682 1:39609804-39609826 AGCGGGGGCTGCAGGGACCCGGG + Intergenic
905729855 1:40289846-40289868 AGCGGAGGCTCCAAAGAAACAGG - Intronic
906333365 1:44906890-44906912 ATTTGGGGATCCAGGTAAACAGG - Intronic
908601543 1:65744978-65745000 AGCTGGAGCTGCTGGGACACAGG - Intergenic
909166578 1:72233927-72233949 AGCTGTGGCTACAGAGAAAAGGG - Intronic
909759266 1:79269037-79269059 AGTTGGGGGTCCAGGGAACTAGG - Intergenic
910277232 1:85462763-85462785 ATCTGGGTCACCAGGGTAACAGG - Intronic
910742491 1:90535210-90535232 AGCTGTGGCTCCCGGGCCACAGG - Intergenic
912866568 1:113263056-113263078 AGAGGGGGCTGCTGGGAAACTGG - Intergenic
913317330 1:117564097-117564119 AGCTGTGGCTCCAGGGACTGTGG + Intergenic
914756027 1:150562058-150562080 ATGTGGGGGGCCAGGGAAACGGG + Intergenic
915583998 1:156833779-156833801 AGCAGGTGCTGCAGGGAGACAGG + Intronic
916020811 1:160790524-160790546 AGCTGGAGTACCAGGGAAGCTGG - Intergenic
916726183 1:167526160-167526182 TGCTGGAACTCCAGGGAAAGGGG + Intergenic
917928680 1:179809133-179809155 TACTGGGGCTTCAGGGAAACTGG + Intronic
918406552 1:184216650-184216672 AGCTGGGGGCCCAGGAAAGCTGG + Intergenic
919730892 1:200913067-200913089 AGCTGGGTCTGCTGGGAATCTGG - Intronic
920192413 1:204202053-204202075 TGCTTGGGCTCCAGGGAATTGGG - Intronic
921340418 1:214128920-214128942 ACCTGGGGTTCTAGGAAAACTGG + Intergenic
921342074 1:214144314-214144336 AGCTGGAACTCAAGGGAGACGGG + Intergenic
921411456 1:214840481-214840503 TGCTGAGGCTGCAGAGAAACGGG - Intergenic
921427566 1:215022016-215022038 AGCTGGAGAACCAAGGAAACTGG - Intronic
922741193 1:228015264-228015286 AGCTGGGATTCCAGGGAAAGGGG + Intronic
923544470 1:234914211-234914233 AGCTGAGGATCTAGGGAATCTGG + Intergenic
1064493359 10:15883588-15883610 AGCTGGAGATCCAGGAAAGCTGG + Intergenic
1066046864 10:31602755-31602777 AGCTGGGGCTCCAGGCAGGCAGG - Intergenic
1066174733 10:32891673-32891695 AGCTGGGTCTGGAGGGTAACAGG + Intergenic
1066652210 10:37667235-37667257 AGCTGGAGCACCAGGAAAGCTGG + Intergenic
1067218427 10:44323163-44323185 AGCTGTTGTTCCAGGCAAACTGG + Intergenic
1067277685 10:44849609-44849631 AGCTGGAGGCCCAGGGAAGCTGG - Intergenic
1068369116 10:56091041-56091063 AGCTGGAGCAGCAGGGATACAGG - Intergenic
1068580199 10:58730792-58730814 AGCTGGGGCAACAGGGATACTGG + Intronic
1069372023 10:67758180-67758202 AGCTGGAGAACCAGGAAAACTGG - Intergenic
1069754100 10:70762659-70762681 AACTTGGGCCTCAGGGAAACAGG - Intergenic
1070622910 10:78027680-78027702 AGCTGGGGTTACAGGCATACAGG + Intronic
1071343173 10:84666786-84666808 AGCTAAGCCTCCAGGGAATCAGG + Intergenic
1072454668 10:95565202-95565224 ACCTGGGTCCACAGGGAAACGGG + Intergenic
1072467550 10:95680557-95680579 ACCTGGATCTCCAGGGAAACTGG + Exonic
1073038852 10:100585078-100585100 AGCTGGAGCTCCAGCGCACCAGG - Intergenic
1073117135 10:101097530-101097552 AGCAGGGGCTCGTGGGTAACTGG + Intronic
1075120355 10:119660044-119660066 GGCTGGGGCTGCAGGGAGGCTGG + Intronic
1076283786 10:129274205-129274227 TGCTGGAGCTGCAGGGAAAAGGG + Intergenic
1076997751 11:307213-307235 AGGTGGGCCTCCAGGGGAAAGGG + Intergenic
1077124211 11:925336-925358 AGCTGGGGCTCCAGGCGAAGGGG - Intronic
1078116267 11:8455044-8455066 AGCTGGGGTCACAGGGAAATGGG - Intronic
1078404207 11:11055071-11055093 AGCTGGGGAACCAGGAAAGCTGG - Intergenic
1078895578 11:15594360-15594382 AGGTGCAGCTCCTGGGAAACTGG + Intergenic
1079500747 11:21098654-21098676 AGCAGGTGCTCCAGGGTCACAGG + Intronic
1081644511 11:44780342-44780364 AGCAGGGGCTCCAGGGAGGATGG + Intronic
1083327350 11:61879559-61879581 GGCTGGGGCTCCAGGAGAATGGG - Intronic
1083728474 11:64640727-64640749 AGGAAGTGCTCCAGGGAAACTGG + Intronic
1083888087 11:65582361-65582383 AGCTGGGGGTTCAGGGGACCTGG + Exonic
1084220357 11:67674160-67674182 CCCTGGGGCTCCTGGGGAACAGG + Intronic
1084410044 11:69001652-69001674 ACCTGAGCCTCCAGGGCAACAGG + Intergenic
1084786930 11:71448107-71448129 CGCTGGGGCTCCGGGGAGGCGGG - Intronic
1085170079 11:74442245-74442267 AGCTGGACCTCCAGGACAACTGG - Intergenic
1085339482 11:75721969-75721991 AGCAGGGCCTCCAGGGCAAAGGG + Intronic
1085397403 11:76213531-76213553 AGATGGGGGTGCAGGAAAACTGG + Intergenic
1085529520 11:77183230-77183252 AGCTGGGGGCCCACGGAAGCAGG + Intronic
1086403365 11:86479287-86479309 AGCTGGAGAACCAGGGAAACTGG - Intronic
1087651586 11:100874627-100874649 AGGTGGTGCCCCAAGGAAACAGG - Intronic
1087983703 11:104650638-104650660 AGCTGGGGTTTGAGGGAAGCTGG - Intergenic
1088367272 11:109052853-109052875 AGCTGGAGAACCAGGGAAGCTGG + Intergenic
1089626020 11:119751565-119751587 AGCAGCGCCTCCAGGGACACAGG - Intergenic
1090699027 11:129278781-129278803 AGTGGGGGCTCCAGGGACACCGG - Intronic
1091217804 11:133913989-133914011 CGCTGGGGCACGAGAGAAACCGG + Intronic
1091279360 11:134373357-134373379 AGCTTGGGCCCCACTGAAACTGG + Intronic
1091980091 12:4857758-4857780 TGCTAGGTCTCCAAGGAAACAGG + Intergenic
1091982750 12:4879619-4879641 AGCTGGAGCACCTGGGACACAGG + Intergenic
1092160857 12:6314794-6314816 AGCTGGAATTCCAGGGAAAAAGG - Intronic
1093214656 12:16348651-16348673 GGCTGGGACCCCAGGAAAACTGG - Intronic
1093351030 12:18103368-18103390 AGCTGGGGCAACTGGGACACAGG + Intronic
1093874315 12:24331003-24331025 TGCTGGAGCTCCGGGGAGACTGG - Intergenic
1094831372 12:34301783-34301805 ACATGGGGACCCAGGGAAACTGG + Intergenic
1094848072 12:34370114-34370136 AAGTGGGGCCCCAGGGAAACTGG - Intergenic
1095943846 12:47742582-47742604 AGATGGGCCTCCAGAGAACCTGG - Intronic
1096712148 12:53465252-53465274 AGCTGGGTCTTCAGGGCAATGGG - Intronic
1096741286 12:53695762-53695784 GGCTGGGGCTGCAGGGAGACAGG + Intergenic
1096870104 12:54587827-54587849 GGCTGGGGCTCCAGGGAGAGGGG - Intronic
1097011464 12:55956201-55956223 AGCAGGGGGCCCAGGGAACCTGG + Exonic
1097020953 12:56020662-56020684 TGCTGGGGCCCCAGGGGCACAGG + Intronic
1097072599 12:56366063-56366085 GGATGGGAGTCCAGGGAAACTGG + Intergenic
1097222468 12:57459355-57459377 AGCCGGGGTTCTAGGGAAAGGGG + Intergenic
1097569499 12:61315414-61315436 ACCAGGGGCTGCAGGGAAAGAGG + Intergenic
1097999077 12:65921848-65921870 AGCTGGAGCTGCTGGGACACAGG - Intronic
1098290190 12:68950825-68950847 AGCTGGGCCTCCAGACAGACTGG - Intronic
1098695593 12:73550243-73550265 TACTGGGGCTGCAGGGAAACTGG + Intergenic
1099775083 12:87116349-87116371 AGCTGGGGCTCAAGAGTGACAGG - Intergenic
1101750748 12:107581007-107581029 GGCAGGGTCTCCAGGGAAAGCGG + Intronic
1101861802 12:108488522-108488544 TGATGGGGCTGCAGGGAAAAGGG + Intergenic
1103444783 12:120987521-120987543 TTCTGGTGCTGCAGGGAAACAGG + Intronic
1103714001 12:122932582-122932604 AGGTGAGGCTGCAGGGAGACAGG + Intronic
1103794685 12:123495129-123495151 TGCTGGGACTCTAGGGAAAGAGG + Intronic
1103882613 12:124177735-124177757 AGCTGGGGCACCAAGGATGCTGG + Intronic
1104310930 12:127653779-127653801 AGCTGTGGCTCCAGGGACGAGGG + Intergenic
1104502988 12:129303762-129303784 AGCTGGGGACCCAGGAAAGCTGG + Intronic
1104735080 12:131131600-131131622 AGCCAGGGCTCCTGGGACACAGG - Intronic
1104936460 12:132366863-132366885 TGCTGGGCATCCAGGGAAAGTGG - Intergenic
1104981171 12:132573707-132573729 ACCAGGGGCGCCAGGGAAAGGGG - Intronic
1105256770 13:18748573-18748595 AGCTGGAGCTGCAGGGATACAGG + Intergenic
1105259873 13:18771060-18771082 AGCTGGAGCTGCAGGGATGCAGG + Intergenic
1105262553 13:18790383-18790405 AGCTGGAGCTGCAGGGATGCAGG + Intergenic
1105264014 13:18800656-18800678 AGCTTGGGCTGCAGGGATGCAGG + Intergenic
1105647477 13:22337275-22337297 TGATGGGGCTCCAGGGGATCTGG - Intergenic
1105708279 13:22982139-22982161 AGCTGAGGGTCCAGAGAACCTGG + Intergenic
1106519131 13:30481736-30481758 GGCTGGTGCTCAAGGGAAAAAGG + Intronic
1106618524 13:31352549-31352571 TGCTGGGGCCCCAGGGTAAAGGG + Intergenic
1106851165 13:33794109-33794131 TGCTGGGGCTTTGGGGAAACAGG + Intergenic
1106916073 13:34515636-34515658 AGCTTGGGCTCTAGGGAAAAAGG + Intergenic
1107511297 13:41088102-41088124 AACTGGGACTACAGGCAAACAGG + Intergenic
1107784512 13:43941620-43941642 AGCTGGAGAACCAGGGAAGCTGG - Intergenic
1110227677 13:73136652-73136674 AGCTGGGACTACAGGCACACAGG + Intergenic
1110356299 13:74571776-74571798 AGCTGGGACTACAGGCACACAGG - Intergenic
1110380491 13:74844814-74844836 AGCTGGAGAACCAGGGAAACTGG + Intergenic
1111111929 13:83722698-83722720 AGCTAGTGCACCAGGGAAAGGGG + Intergenic
1112498334 13:99923047-99923069 AGCTGGTGCTTCAGGCACACAGG + Intergenic
1112802659 13:103129717-103129739 AGCTGGAGAACCAGGGAAAATGG - Intergenic
1113288786 13:108883047-108883069 AGCTGGGACACCTGGAAAACAGG - Exonic
1114413281 14:22520037-22520059 AGGTGAGGCTCCAGGGAATGGGG - Intergenic
1114437916 14:22723554-22723576 AGCTGGCTCTGCAGGGGAACAGG + Intergenic
1116998276 14:51346883-51346905 AGCTGGAGCAGCTGGGAAACAGG - Intergenic
1118356764 14:65020555-65020577 AGCTGGGACTACAGGCATACAGG + Intronic
1119033766 14:71212899-71212921 AGCTGGGATTCCAGGAAAGCAGG + Intergenic
1119118004 14:72045052-72045074 AGCTGGAGAACCAGGGAAGCTGG - Intronic
1119266787 14:73267437-73267459 ATCTGGAGCTCCTGGGACACTGG - Intronic
1120017570 14:79491237-79491259 GGCTTGGGCTCCAGGCAAAATGG - Intronic
1120618291 14:86733748-86733770 AGCCGGAGCTCCAGGGGATCTGG - Intergenic
1120720083 14:87881113-87881135 AGCTGGGTCTTCAGGGAGACAGG - Intronic
1121812843 14:96906809-96906831 AGCTGGGGTTACAGGGTACCTGG - Intronic
1121873462 14:97430247-97430269 AGCTGGGCCTCCAGGAAAAGAGG - Intergenic
1122255343 14:100472197-100472219 AGCCGGGGCTCCAGGGCTCCAGG - Intronic
1122649202 14:103216498-103216520 ATCTGTGACTTCAGGGAAACGGG + Intergenic
1125589004 15:40843417-40843439 AGCCTGGGCTCCAGGGAAGGGGG + Intergenic
1125609049 15:40958604-40958626 GGCTGGGGCTCCTGGGACAGTGG + Intergenic
1126193248 15:45901229-45901251 AGCTGGGGTAAGAGGGAAACTGG - Intergenic
1126589346 15:50323732-50323754 AGCTGGGACTACAGGAAGACAGG - Intronic
1126819065 15:52483341-52483363 AGCAGGGGCCCCAGGTCAACAGG + Intronic
1128070553 15:64793541-64793563 AGCTGGGACTACAGGCATACAGG - Intergenic
1128617420 15:69121097-69121119 TACGGGGGCTCCAGGGAAACTGG + Intergenic
1132411665 15:101583318-101583340 TGCTAGGGATGCAGGGAAACTGG - Intergenic
1132589583 16:720851-720873 GGCTAGAGCCCCAGGGAAACGGG - Intronic
1132590741 16:725338-725360 AGCAGGGGCCTCAGTGAAACTGG - Intronic
1132803605 16:1765837-1765859 AGCTGGGTCTGCTGGGAAAGTGG + Intronic
1132859601 16:2063544-2063566 AGCTGCGCCTCCTGGGAAAGGGG - Intronic
1132880521 16:2159939-2159961 AGGTGTGTCTCCAGGGAAAGGGG + Intronic
1132938703 16:2496258-2496280 AGCTGGCGCGCCAGGGCTACTGG + Exonic
1133052280 16:3124083-3124105 ACCTGGGGCCGCAGGGAAGCAGG - Intergenic
1133104481 16:3498030-3498052 AGCTGGAGAACCAGGAAAACTGG + Intergenic
1133259182 16:4537716-4537738 ACCTGGGGCTCTTGGGAAACGGG - Intronic
1133733396 16:8595336-8595358 AACTGAGGCTCCAGGAAAAAAGG - Intergenic
1133979269 16:10621519-10621541 AGCTGGGACTACAGGGCTACAGG - Intergenic
1134174272 16:11993245-11993267 CCCTGGAGCTCCAGGTAAACTGG - Intronic
1135116923 16:19731803-19731825 AGCTGGAGAACCAGGGAAGCTGG + Intronic
1136382251 16:29901105-29901127 AGCTGGGGGGACAGGGGAACTGG + Exonic
1137520563 16:49191590-49191612 AACTGGGTCTCCAGGGAAAGGGG + Intergenic
1137774162 16:51041682-51041704 AGCTGGAGCTCTGGGGAAAGGGG + Intergenic
1139962306 16:70725069-70725091 AGCTGGGGCCAGAGGCAAACAGG + Intronic
1139975089 16:70803702-70803724 AGCTGGAGTTTCAGGGCAACAGG + Intergenic
1140474107 16:75230022-75230044 AGCTGGGGCAGGAGGGAAGCAGG + Exonic
1140647146 16:77045040-77045062 AGCTGGGAGTTCAGGGAAAAGGG - Intergenic
1141179427 16:81742454-81742476 GGCTGGGGCTCCAGGGAGATAGG - Intronic
1141661992 16:85446493-85446515 ACCGGGGGCTCCTGGCAAACAGG - Intergenic
1141781205 16:86162765-86162787 AGCCGGAGCTCCAGGAAAGCGGG + Intergenic
1142495903 17:306221-306243 AGCTGGGGTTCCAGGGGGGCTGG - Intronic
1142551786 17:745264-745286 AGCTATGGCTGCAGAGAAACTGG + Exonic
1142737084 17:1907899-1907921 AAATGGCTCTCCAGGGAAACGGG + Intergenic
1142741334 17:1933434-1933456 CTCTGGGGGTCCAGGGAAAGTGG + Intergenic
1142865490 17:2788660-2788682 AGCTGGGGATCCAGGAAAGCTGG + Intronic
1143646187 17:8231877-8231899 AACTGGGACTCCAGGGACCCAGG - Intronic
1143793748 17:9319606-9319628 ATCTTGGTCTCCAGGGAAAAAGG + Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144662503 17:17080342-17080364 AGCTGGAGCTCCTGGGCTACAGG - Intronic
1146259032 17:31409825-31409847 AGCTGGGGCTCCTGGGTTCCGGG - Intronic
1146774055 17:35596666-35596688 AGCTGGTGCTCGAGGGCGACGGG - Intronic
1147202114 17:38809590-38809612 AGCCTGGGCTGCTGGGAAACAGG - Intronic
1147218584 17:38915039-38915061 TGCTGGGGCTGCTGGTAAACTGG - Exonic
1147537257 17:41328772-41328794 ATCTGGGGCTGCGGGGAAGCTGG - Intergenic
1147865540 17:43549621-43549643 AACTTAGGCTCCTGGGAAACAGG - Intronic
1148127341 17:45243613-45243635 AACTGGGAATCCAGAGAAACTGG - Intronic
1148209324 17:45798766-45798788 AGCCGGGGCCCCAGGGAGAAAGG + Intronic
1148346569 17:46907476-46907498 AGCTGGGGCTGGAGAGAAAGAGG - Intergenic
1148789669 17:50166228-50166250 AGCTGGGGATCCAGGGAATGGGG + Intronic
1148887517 17:50784685-50784707 AGCTGGGACCCCAGGGCAAAGGG - Intergenic
1149510551 17:57237545-57237567 AGCTGGACCTTCAGGGAAGCAGG - Intergenic
1149602172 17:57900061-57900083 AGCTGGGCCTGCAGGGAACCAGG - Intronic
1150264285 17:63821879-63821901 AGCAAGGGCTCCAGGCAATCTGG - Intronic
1150654889 17:67033153-67033175 AGCTGGGTCTCCGGGGACCCTGG + Exonic
1151265550 17:72952479-72952501 AGATGGGGCTCCATGGCAGCAGG - Intronic
1151429140 17:74050879-74050901 AGATGGGGCTCCGAGGAGACAGG - Intergenic
1152002292 17:77654411-77654433 AGCACGAGCTCCAGGGAAAGAGG - Intergenic
1153046045 18:856670-856692 AGGTATGGCTCCAGGGACACAGG - Intergenic
1153539103 18:6135168-6135190 AGCTGGAGCAGCTGGGAAACAGG + Intronic
1153614519 18:6921849-6921871 ATCAGGAGCTCCAGGGAAGCTGG + Intergenic
1154424360 18:14260729-14260751 AGCTGGGGCTGCAGGGATGCAGG - Intergenic
1154426149 18:14273741-14273763 AGCTGGAGCTGCAGGGATGCAGG - Intergenic
1154426569 18:14276862-14276884 AGCTGGAGCTTCAGGGATGCAGG - Intergenic
1154427048 18:14280082-14280104 AGCTGGGGCTGCTGGGATGCAGG - Intergenic
1154428883 18:14293325-14293347 AGCTGGAGCTGCAGGGATACAGG - Intergenic
1154429312 18:14296454-14296476 AGCTGGAGCTTCAGGGATGCAGG - Intergenic
1154429775 18:14299614-14299636 AGCTGGGGCTGCCGGGATGCAGG - Intergenic
1154430209 18:14302847-14302869 AGATGGAGCTCCAGGGATGCAGG - Intergenic
1154431162 18:14309670-14309692 AGCTGGAGCTGCAGGGATGCAGG - Intergenic
1154431582 18:14312803-14312825 AGCTGGAGCTGCAGGGATGCAGG - Intergenic
1154433838 18:14328975-14328997 AGCTGGAGCTGCAGGGATGCAGG - Intergenic
1154434270 18:14332106-14332128 AGCTGGAGCTGCAGGGATGCAGG - Intergenic
1154492523 18:14932693-14932715 AGCAGGGGCTACAGGGAGAATGG - Intergenic
1155283867 18:24269025-24269047 AGCTGGTACTCCAGGGAATGTGG - Intronic
1155745792 18:29355527-29355549 AGCTGGAGCTGCTGGGACACAGG - Intergenic
1156850168 18:41716855-41716877 AGCAGTGACTCCAGGGAAGCAGG + Intergenic
1157228341 18:45889070-45889092 GGCTGGGGCTCCTGGGAAGGAGG - Intronic
1157589339 18:48826956-48826978 AGCTGGGGCTTAAGGGAAAGTGG + Intronic
1157605427 18:48923192-48923214 AGCTGGGGCTGCAGGGAGCGAGG - Intronic
1158142388 18:54269485-54269507 CGCCTGGTCTCCAGGGAAACCGG - Exonic
1159102374 18:63970712-63970734 AGCTTGGGCGCCAGGGGAGCAGG - Intronic
1160266895 18:77345901-77345923 AGCTGGTGTTCCAGGAAAGCTGG - Intergenic
1161285991 19:3468532-3468554 AGCAAGGGCTCCAGGGGGACAGG + Intronic
1161475089 19:4480319-4480341 AGCTGGGGGGCCAGGGAGTCAGG - Intronic
1161758445 19:6152225-6152247 AACTCGGCCTCCAGGGTAACTGG + Intronic
1162782345 19:13012844-13012866 AGGTGAGGCTCCTCGGAAACCGG - Intronic
1163092972 19:15034146-15034168 AGCTGGGACTACAGGCATACAGG - Intergenic
1163154272 19:15431671-15431693 AGCTGGGGCTGCAGAGACAATGG + Intronic
1163444266 19:17337663-17337685 AGGTGGGGCTACAGGGGAAGGGG + Exonic
1163862667 19:19750325-19750347 ATCTGGGGCTGCAGAGCAACTGG - Intergenic
1164520827 19:28977859-28977881 AGCTGGGGCTCCAGAGACCCTGG - Intergenic
1164534516 19:29075377-29075399 AGGTGAGGCTCCTGGGAAAGAGG - Intergenic
1164686178 19:30168228-30168250 AGCTGGGGCTGCCGAGAAGCTGG - Intergenic
1164884872 19:31769978-31770000 AATTGGGCCTCCAGGGACACAGG - Intergenic
1164934478 19:32200408-32200430 AGCTGAGGCTCCAGGGCACATGG - Intergenic
1165329630 19:35134417-35134439 TGCCGGGTCTCCAGGGAAACAGG - Intronic
1165464301 19:35963669-35963691 TGCTTGGGCTGCTGGGAAACAGG + Intergenic
1165717335 19:38054911-38054933 AGCAGGGGCTCCCGGGAACATGG - Intronic
1165832695 19:38737117-38737139 AGCTGAGGCTGGAGGGAACCCGG - Intronic
1166253314 19:41585894-41585916 AGCTGGGGCCCCAGTGGAAATGG - Intronic
1167676276 19:50887981-50888003 GGCTGGGGATCCAGGGACACAGG + Intergenic
1167776841 19:51564104-51564126 AGCCGTGGCTCCAGGGAAGTGGG + Intergenic
1168057353 19:53870519-53870541 AGCTTGGGCTCCAAGGAATAGGG + Intronic
924960839 2:33032-33054 AGCTGGGGAACCAGGGAAGACGG - Intergenic
925151694 2:1619421-1619443 AGCGGGGGCTGGAGGGAGACTGG - Intergenic
925151706 2:1619464-1619486 AGCGGGGGCTGGAGGGAGACTGG - Intergenic
925438398 2:3862511-3862533 AGCTGGAGAACCAGGGAAGCTGG + Intergenic
926678935 2:15649577-15649599 AGCTGGGGAGCCAGGGAGATGGG - Intergenic
927375197 2:22405323-22405345 AGCAGGGGCTCCAGGATAAAAGG + Intergenic
928468475 2:31547744-31547766 AGCTGGAGTGCCAGGGAAGCTGG - Intronic
928884686 2:36134864-36134886 AGCTGGGGAACCAGGAAAGCTGG - Intergenic
928940301 2:36720674-36720696 GGCTGGGGAGCCAGGGAAATAGG + Intronic
928952154 2:36822821-36822843 AGCTGGGGGAAGAGGGAAACAGG - Intergenic
929770064 2:44884409-44884431 AGCTGGGTCTCCAGATAAAAAGG + Intergenic
929853508 2:45614698-45614720 AGCTGGAGGGCCAGGGAAGCTGG - Intergenic
931216884 2:60253644-60253666 AGGTGGGGCTCCAGCATAACAGG + Intergenic
931230274 2:60368576-60368598 AGCAGTGGCAGCAGGGAAACAGG + Intergenic
932784468 2:74587796-74587818 AGCTTGGGCTGCAGTGAACCAGG - Intronic
933560780 2:83883446-83883468 AGCTGGAGACCCAGGGAAGCTGG + Intergenic
933821396 2:86115474-86115496 AGGTGAGGCTCAAGGGAAAGGGG + Intronic
934048397 2:88190465-88190487 AGCTGTGTCCCCAGGAAAACGGG + Intergenic
934491830 2:94766393-94766415 AGCTGGAGCTGCAGGGATGCAGG + Intergenic
934493234 2:94776571-94776593 AGCTGGAGCTGCAGGGATGCAGG + Intergenic
934493693 2:94779782-94779804 AGCTGGGGCTGCTGGGATGCAGG + Intergenic
934494847 2:94788086-94788108 ATCTGGGGCTGCAGGGCAGCTGG + Intergenic
936837952 2:116730915-116730937 AACTGGGGCTAAAGGGAAATGGG - Intergenic
937818368 2:126279162-126279184 AGATGGAGCACCAGGGCAACAGG - Intergenic
937880590 2:126861623-126861645 AGCTGGAGAACCAGGGAAGCTGG + Intergenic
938248559 2:129796974-129796996 GCCTGGGGCTCCAGGGTGACTGG - Intergenic
938280130 2:130057890-130057912 AGCTGGGGCTGCAGGGATGCAGG + Intergenic
938331087 2:130448605-130448627 AGCTGGGGCTGCAGGGATGCAGG + Intergenic
938358861 2:130672898-130672920 AGCTGGGGCTGCAGGGATGCAGG - Intergenic
938382738 2:130845810-130845832 GGATGGGCCTCCAGGGAACCAGG + Intronic
938435254 2:131279551-131279573 AGCTGGGGCTGCAGGGATGCAGG - Intronic
939208178 2:139134724-139134746 AGCTGGAGACCCAGGAAAACTGG - Intergenic
939639311 2:144619797-144619819 TGCTGGTGCTGCAGGGAAATAGG + Intergenic
940986537 2:160057296-160057318 AGCCAGGCCTCCTGGGAAACAGG - Intronic
941416834 2:165231511-165231533 AGCTGGAGAACCAGGGAAGCTGG + Intergenic
941463927 2:165802677-165802699 AGCTGCATCTCCAGTGAAACAGG + Intergenic
941804975 2:169703144-169703166 AGCTGAGGCTCCACTGAAGCAGG + Intronic
941805124 2:169704427-169704449 AGCTAGGGCTCCACTGAACCAGG - Intronic
943174347 2:184450605-184450627 AGTTGGGGCTCCTAGGAAAATGG + Intergenic
943523910 2:188992912-188992934 ACCAGGGGATCCAGGGAATCCGG - Exonic
944368721 2:198955667-198955689 AGCTGGAGACCCAGGAAAACTGG - Intergenic
945275962 2:207987853-207987875 AGCTAGGAGTCCAGTGAAACAGG - Intronic
945909017 2:215625324-215625346 ATCTGGGGTTCCAGGGAAACTGG - Intergenic
946106235 2:217372381-217372403 ATTTGGGGCCCCTGGGAAACAGG + Intronic
947028195 2:225762699-225762721 AGCTGGAGCACCAGGGAAGCTGG - Intergenic
947034778 2:225839757-225839779 AGCTGGGACTTCATGGAGACTGG - Intergenic
947171670 2:227318805-227318827 AGCTGGAGAACCAGGAAAACTGG + Intergenic
947295950 2:228630437-228630459 GGCTAGGGGTTCAGGGAAACAGG + Intergenic
948247207 2:236496590-236496612 AGCAAGGGCTCCAGGGAGAGAGG + Intronic
948890816 2:240906267-240906289 AGCTGGGTTTCCCTGGAAACAGG - Intergenic
1169072408 20:2740952-2740974 AGCTGGGGCATGAGGGAATCAGG + Intronic
1169194993 20:3678174-3678196 AGCAGGGGCTGCAGAGGAACAGG - Intronic
1169266789 20:4172044-4172066 AGGTGGTGCTCCAGGGAGCCTGG + Intronic
1170490656 20:16870632-16870654 AGCTGGAGAACCAGGGAAACCGG + Intergenic
1170735864 20:19013706-19013728 AGCAGAGGCTGCGGGGAAACAGG + Intergenic
1170802404 20:19601339-19601361 AACTGGGGCACCAAAGAAACAGG - Intronic
1170955064 20:20972404-20972426 AGCTGAGCTTCCTGGGAAACGGG - Intergenic
1171186396 20:23126947-23126969 CGCTGGGGGTCCAGGGTCACAGG + Intergenic
1171962990 20:31508579-31508601 AGCTGGGGCTCCAGAGAGCATGG - Intergenic
1172178046 20:32984532-32984554 AACTGAGGCTCCAGAGAAGCAGG + Intronic
1172242661 20:33423570-33423592 AGCTGGAGCTCCCTGGAAATTGG - Intronic
1173349331 20:42230863-42230885 ATCTGGGGACCCAGGGACACAGG - Intronic
1173946459 20:46954774-46954796 AGCTGCGTCCCCAGGGAAATAGG + Intronic
1175732118 20:61361216-61361238 AGCAGGGTCTCCAGAGCAACGGG - Intronic
1176842763 21:13853619-13853641 AGCTGGAGCTGCAGGGATGCAGG + Intergenic
1176845885 21:13876100-13876122 AGCTGGAGCTGCAGGGATGCAGG + Intergenic
1176848187 21:13892516-13892538 AGCTGGGGCTGCAGGGATGCAGG + Intergenic
1176848618 21:13895643-13895665 AGCTGGAGCTGCAGGGATGCAGG + Intergenic
1177390916 21:20470517-20470539 AGCTGGGGAACCAGGAAAACCGG - Intergenic
1177744725 21:25197881-25197903 AGCTGGAGAACCAGGGAAGCAGG + Intergenic
1178003532 21:28191917-28191939 AGATTGGACTCCAGGGAACCTGG + Intergenic
1179477812 21:41659262-41659284 GGCTTTGGATCCAGGGAAACAGG - Intergenic
1179982101 21:44900961-44900983 CGCTGGGACTGCAGGGAAGCAGG + Intronic
1181042554 22:20199088-20199110 AGCTGAGTCTCCAAGGAAGCTGG - Intergenic
1181299552 22:21869750-21869772 AGCTGGGACTACAGGCACACCGG - Intergenic
1181441777 22:22939822-22939844 AGTTGAGGCTACAGGGACACAGG + Intergenic
1181538129 22:23557386-23557408 AGCTGAGGCTCTTGGGAAAATGG + Intergenic
1182314707 22:29437868-29437890 ATCTGGGGATCCAGGGTGACTGG - Intergenic
1182746572 22:32610418-32610440 GGAAGGGGCTCCAGGGAAATGGG - Intronic
1183210822 22:36450049-36450071 AGCTGGGGGTGATGGGAAACAGG + Intergenic
1185114481 22:48923817-48923839 AGCTGGAGGCCCAGGAAAACTGG - Intergenic
949426997 3:3928508-3928530 ACCTGGAGAACCAGGGAAACTGG + Intronic
950413442 3:12854201-12854223 GACTGGGGCTCCAAGGAAAGTGG + Intronic
950703608 3:14766803-14766825 AGGTGGGGCGCCAGGGTAGCTGG + Intronic
950832231 3:15886203-15886225 AGCTGGATACCCAGGGAAACTGG - Intergenic
950905705 3:16536089-16536111 TGCTGAGGCTGCAGGGAAGCTGG - Intergenic
952382506 3:32816515-32816537 GGAGGGGGCTCCAGGCAAACAGG - Intergenic
952665191 3:35895519-35895541 AGCTGGGGCCCAAGGGGAATTGG - Intergenic
953417672 3:42732264-42732286 CTCTGTGGCTCCAGGCAAACTGG - Intronic
953517325 3:43607418-43607440 AGCAGAGGCCCCAGAGAAACTGG - Intronic
954180912 3:48880708-48880730 AGCTGGGACTACAGGCAAGCCGG + Intronic
954592877 3:51798805-51798827 AGCTTGGGATCCAGAGAACCAGG + Intergenic
954716772 3:52530872-52530894 AGCAGGGGCTGCAGGGAGAAGGG + Intronic
954796829 3:53165731-53165753 TGCTCGGGCTCCAGAGAAGCTGG - Intronic
955868215 3:63408459-63408481 AGCTGGAGAACCAGGGAAGCTGG + Intronic
957821942 3:85388052-85388074 AACTGGCTCTCCAGGGAACCAGG + Intronic
957960977 3:87252246-87252268 AACTGGGGCTCCTGGCAAATAGG - Intronic
958433644 3:94071885-94071907 ACCTGGGGCTGGAGGGAAAGTGG - Intronic
959756526 3:109906094-109906116 AGCTGGAGCAGCTGGGAAACAGG + Intergenic
960573405 3:119206770-119206792 GGCTGGGCCTCCAGGGAAGGTGG - Intergenic
961451337 3:127003643-127003665 GGCTGGGTCTGCAGGGGAACCGG + Intronic
961805935 3:129489314-129489336 GACTGGGGCTCCAAGGAAAGTGG - Intronic
962479011 3:135782421-135782443 AGCTGAGAGTCCAAGGAAACTGG - Intergenic
963017857 3:140842640-140842662 AGCTGAAGCACCAGGGAAGCTGG - Intergenic
963226355 3:142866408-142866430 AGCTGGTGAACCAGGAAAACTGG - Intronic
963914058 3:150841409-150841431 GGCTGGGGCCCCAGTGAGACAGG + Intergenic
964493601 3:157264354-157264376 AGCTGGAGAACCAGGAAAACTGG - Intronic
966297441 3:178440619-178440641 CGCATGGGCCCCAGGGAAACTGG + Intronic
966613161 3:181888440-181888462 AGCTGGGACTACAGGCACACAGG - Intergenic
967054006 3:185812154-185812176 AGGTGGGGCTCCACGAACACAGG - Intronic
967519882 3:190416850-190416872 AGCTGGAGCTGCTGGGACACAGG + Intergenic
967966255 3:194962307-194962329 AGCTGGGGGTGCAGGGAGGCGGG - Intergenic
968001504 3:195209756-195209778 AGCTGGGCCTCCAGAGAGAGTGG - Intronic
968350795 3:198050194-198050216 AGCTGGAGCTGCAGGGATGCAGG + Intergenic
968768305 4:2486618-2486640 AGCTGGGCCTGCAGGGATGCAGG + Intronic
969428742 4:7140768-7140790 GAGTGGGGCTCCAGGGAAAGTGG - Intergenic
969875575 4:10133496-10133518 AGCTGGGGCACCTGGGCAAGAGG + Intergenic
969973546 4:11073444-11073466 ACCTGGGGCTCAAGGCTAACTGG + Intergenic
969984564 4:11194355-11194377 GGCTTGAGCTCCTGGGAAACAGG - Intergenic
970331895 4:14995150-14995172 AGTTGGGACTCCAGGAACACAGG - Intergenic
970709366 4:18843581-18843603 AGCTGGAGATCCAGGAAAGCTGG - Intergenic
972794064 4:42398635-42398657 AGCTGGAGCTCCCGGGAGAAGGG + Intronic
973275188 4:48299654-48299676 AGCTGGGATTCTAGGCAAACAGG + Intergenic
973884397 4:55306094-55306116 TGTGGGGGCTCCAGGGAAAGTGG - Intergenic
976248536 4:83027380-83027402 AGCTGGGACTACAGGCACACTGG - Intergenic
976427977 4:84928351-84928373 AGCTGGAGAACCAGGGAAGCTGG - Intronic
977745276 4:100539747-100539769 AACTGGGGCTGAAAGGAAACGGG + Intronic
980133258 4:128835941-128835963 GGCTGGGCCTCCAGGGCACCTGG - Intronic
980526894 4:134000888-134000910 AGCTGGAGACCCAGGAAAACCGG - Intergenic
981502112 4:145463101-145463123 AGGTGGAGCTCCAGGGAGATAGG - Intergenic
982741521 4:159061845-159061867 AGCAGGAGCACCATGGAAACTGG + Intergenic
984076523 4:175188265-175188287 AGCTGGAGGCTCAGGGAAACTGG - Intergenic
984571948 4:181404852-181404874 AACTGGAGCGCCTGGGAAACAGG + Intergenic
984620209 4:181944200-181944222 AGCTGGAGCCCCAGGAAAGCTGG + Intergenic
985529849 5:427564-427586 CGCCGCGGCTCCAGAGAAACTGG + Intronic
986469077 5:8056610-8056632 AGCTGAGGCCCCAGGCAAGCAGG - Intergenic
986569649 5:9151944-9151966 AGCTGGTGCTCCAGGCACAGAGG - Intronic
986785321 5:11108948-11108970 AGATTGGGGTCCAGGGAAATAGG - Intronic
987650419 5:20733355-20733377 AGCTGGAGCTGCTGGGACACAGG + Intergenic
987796469 5:22633756-22633778 AGCTGGAGATCCAGGAAAGCTGG - Intronic
988040965 5:25888395-25888417 AGCTGGAGCATCAGGGACACAGG + Intergenic
988682792 5:33500516-33500538 AGCTGGGGCCCCAGGCCAACAGG + Intergenic
988745132 5:34128111-34128133 AGCTGGAGCTGCTGGGACACAGG - Intergenic
989198210 5:38736686-38736708 TGCTAAGGCTTCAGGGAAACAGG + Intergenic
989425191 5:41288711-41288733 ACCTGGGCCTCCAGGTTAACTGG - Intergenic
989568611 5:42924983-42925005 ACCTGGTGCTCCAGGTAGACAGG - Intergenic
990240317 5:53810535-53810557 AGCTGGAGAACCAGGGAAGCTGG + Intergenic
990559387 5:56968245-56968267 AGCTGGAGAACCAGGGAAGCAGG - Intronic
990996124 5:61733924-61733946 ATCTGTGGCTCCAGACAAACTGG + Intronic
991631004 5:68656333-68656355 GGATGGGTCTCCAGGGAAAGGGG - Intergenic
993707924 5:91192561-91192583 AGCTGGGACTACAGGTATACAGG - Intergenic
993891781 5:93483285-93483307 TGCTGGTGATCCAGGCAAACAGG + Intergenic
994285137 5:97955753-97955775 AGCTGGAGCTGCTGGGATACAGG - Intergenic
994490442 5:100436207-100436229 AGCTGGAGAACCAGAGAAACTGG - Intergenic
996351303 5:122544969-122544991 AGCAGGGAATCCAGGGAAATTGG - Intergenic
996480930 5:123974033-123974055 AGCTGGAGCTCCTGGGATGCAGG + Intergenic
996530804 5:124524954-124524976 ACCTGGAGATCCACGGAAACTGG - Intergenic
997414182 5:133712362-133712384 AGATGGGGCACCATGGAGACAGG - Intergenic
997619205 5:135273807-135273829 GGCTGGAGGTCCAGGGAAACAGG - Intronic
998367286 5:141639654-141639676 GGCAGGTGCTCCAGGGAAAGGGG + Exonic
999712745 5:154332827-154332849 AGCTGGTGCTTCAGAAAAACAGG - Intronic
1000275296 5:159728954-159728976 AGCTGGGGCACGAGGGGAAATGG - Intergenic
1000565648 5:162843646-162843668 AGCTGGAGGCCCAGGAAAACTGG - Intergenic
1001280225 5:170381474-170381496 GGCTGGGGCTCCAGGCTAGCTGG - Intronic
1001342694 5:170862161-170862183 GGCTGGGACTCCGGGGACACCGG - Intronic
1002137612 5:177117531-177117553 ACCTCGGCCTCCAGGGTAACTGG - Intergenic
1002595949 5:180323334-180323356 GGCCGGGTCTCCTGGGAAACGGG - Intronic
1002815803 6:678691-678713 GCATGGGGCTCCAGGGCAACAGG + Intronic
1002881321 6:1255002-1255024 AGCTGCAGCTCCAGGAAAGCAGG - Intergenic
1003076808 6:2989274-2989296 GGCTGGGGCCCGCGGGAAACCGG + Intronic
1003123998 6:3340711-3340733 AGATGGGGCTACTGGGAAAAGGG + Intronic
1003192668 6:3888192-3888214 TGCTGGGGCCCCAGGGAACACGG - Intergenic
1005188909 6:23195721-23195743 AGCTGGCATTCCAGGGAATCTGG - Intergenic
1005225796 6:23640328-23640350 ATCTAAGGCTACAGGGAAACAGG + Intergenic
1005512974 6:26528837-26528859 AGCTGGAGCCCCAGAAAAACAGG + Intergenic
1005543254 6:26835865-26835887 AGCTGGAGCTGCTGGGACACGGG - Intergenic
1006328081 6:33369018-33369040 TGCTGAAGCTCCAGGGCAACAGG + Intergenic
1006752149 6:36385332-36385354 AGCTGGGACTACAGGCACACTGG - Intronic
1006830794 6:36967103-36967125 AGCTCAGGCTCCAGAGATACAGG + Intergenic
1007286004 6:40747920-40747942 AACTGAGGCTCAAGAGAAACAGG - Intergenic
1009014081 6:57878030-57878052 AGCTGGAGCTGCTGGGACACAGG - Intergenic
1011738287 6:90334080-90334102 AGCTGGAGCTGCTGGGACACAGG + Intergenic
1011854602 6:91673654-91673676 AACTGGGGCTTCGGGGAAATGGG + Intergenic
1013348802 6:109287860-109287882 AACTAGTGCTCCAGGGAGACAGG + Intergenic
1014028216 6:116672787-116672809 AGCTAGAGCACCAGAGAAACTGG - Intergenic
1015241903 6:131033768-131033790 ACCTGGGGCTGCAAGGAAAAAGG + Intronic
1015273328 6:131359338-131359360 AGCCGGAGAACCAGGGAAACTGG + Intergenic
1015519228 6:134114633-134114655 AGCTGGGGCCCCTGTGAAAATGG + Intergenic
1016547988 6:145245679-145245701 AGCTAGGGCTGGAGGAAAACTGG + Intergenic
1017489640 6:154933698-154933720 AGCAGAGGCTCCAGGGAGAAGGG + Intronic
1017533867 6:155326274-155326296 TGTTAGGGCTCCAGGGCAACTGG + Intergenic
1017886511 6:158604174-158604196 GGCTGGGAGTCCAGGGAGACAGG - Intronic
1018727041 6:166620949-166620971 AGCAGGGGCAGGAGGGAAACAGG + Intronic
1018739635 6:166717512-166717534 AGCTGGGGTTCCAAGGAAACTGG + Intronic
1018743707 6:166748603-166748625 AGGTGGGGGCCCAGGGAAATGGG - Intronic
1019142097 6:169954840-169954862 AGCTGGAGAACCAGGGAAGCTGG - Intergenic
1019228325 6:170534099-170534121 AGCTGGGGAGCCAGAGAAACTGG - Intergenic
1019360597 7:602460-602482 AGGTGGGGCTCCCGGGAGCCTGG + Intronic
1019552571 7:1610500-1610522 AGATGGGTCTCCAGGAAAGCAGG + Intergenic
1019603585 7:1897520-1897542 AGCTGGAGACCCAGGGCAACAGG - Intronic
1020054085 7:5104984-5105006 AGCTGTGGCTCCAGGACTACAGG + Intergenic
1021308797 7:19065661-19065683 AGCAGTGGCTCAAAGGAAACAGG + Intronic
1021889278 7:25171854-25171876 AACTGGGGCCACAGGGGAACTGG - Intronic
1021925034 7:25526048-25526070 AACTGGGGCTGGAGGGAAAGGGG + Intergenic
1022972140 7:35528160-35528182 AGCTGGGCCTCCAGGTGACCTGG + Intergenic
1023224391 7:37953528-37953550 AGCTGGGACTGCAGAGAAAGTGG - Intronic
1024053551 7:45645483-45645505 AGCAGGGCCTCCAGGGTAAAAGG - Intronic
1024487671 7:49937789-49937811 AGCTGGGGAAACAGGGAAATGGG - Intronic
1026111592 7:67462843-67462865 AGATGGGCCTCCAGGGCAGCAGG + Intergenic
1026343377 7:69453236-69453258 AGCTGGGACTACAGGCAAAACGG - Intergenic
1026514629 7:71058211-71058233 AGCTGGAGAACCAGGAAAACAGG + Intergenic
1026849432 7:73715860-73715882 AGCTGGGTCTCCAGGAAAGACGG + Intronic
1027869621 7:83690772-83690794 AGATGGGGCTCCAGGGAATTTGG + Intergenic
1028684121 7:93574346-93574368 AGGTGTGGCTCCAGGGACTCAGG + Exonic
1029630905 7:101749545-101749567 AGGTGGGGGACCAGGGGAACTGG - Intergenic
1029664356 7:101985344-101985366 CCCTGGGGGTTCAGGGAAACTGG + Intronic
1031183521 7:118446739-118446761 AGCTGGAGAACCAGGGAAGCTGG + Intergenic
1031636575 7:124108302-124108324 AGCTGGAGACCCAGGGAAAATGG - Intergenic
1032500842 7:132398583-132398605 AGCCTGGGCTCCAGGGACGCAGG + Intronic
1033220327 7:139523373-139523395 TGCTGTGGCTCCAGGGCAGCCGG + Intergenic
1033252039 7:139768771-139768793 AGGTGGGGCTCCAGGTATAGTGG - Intronic
1034056349 7:148039101-148039123 AGCTGGAGAACCAGGGAAGCTGG + Intronic
1034120175 7:148619881-148619903 AGGAAGGGCTTCAGGGAAACAGG - Intergenic
1034257448 7:149732455-149732477 AGCTGGGGGCCCAGAGAAACAGG + Intronic
1034439152 7:151077701-151077723 AGCTGGAGCTCCCAGGATACCGG - Exonic
1034490924 7:151392655-151392677 AGCTGAGGCTCCGGGGCCACCGG + Intronic
1034863689 7:154622389-154622411 AGCAGAGGCTACAGGTAAACAGG - Intronic
1035477176 7:159152106-159152128 AGCTGGAGCACCAGGGAGGCTGG + Intergenic
1035599028 8:884273-884295 TGCTGAGGCTGCAGAGAAACAGG - Intergenic
1035770046 8:2139659-2139681 AGCTGGTGCCCGAGAGAAACAGG + Intronic
1036508677 8:9380312-9380334 AGCTCGGGCTCCAGGAGAAACGG + Intergenic
1036980676 8:13466620-13466642 TGATGGGGCTCCAGGGAAGATGG - Intronic
1037173485 8:15921249-15921271 AGCTGGAGAACCAGGGAAGCTGG + Intergenic
1037467151 8:19172002-19172024 AGGCGGGGCTCCAGGGAATGGGG - Intergenic
1038323419 8:26550737-26550759 AGCTGGAGAACCAGGGAAGCTGG + Intronic
1039825092 8:41166252-41166274 AGCTGGGACTACAGGCAGACAGG + Intergenic
1039969513 8:42309089-42309111 TGATGGGGCGCCAGGGAAACAGG - Intronic
1040646583 8:49403831-49403853 AGCTGGAGAACCAGGGAAGCTGG - Intergenic
1040904638 8:52453724-52453746 AGCTGGTGATCCAGGAAAGCAGG - Intronic
1041616680 8:59915503-59915525 AGCTGGGGATCCATGGAGTCAGG - Intergenic
1041723360 8:60996299-60996321 AGCTCGTGCTCCAGTGACACAGG - Intergenic
1043331202 8:79120663-79120685 GGTTGAGGCTCCAGGGAAAATGG + Intergenic
1044025808 8:87170678-87170700 AGCTGGGTATACAAGGAAACTGG - Intronic
1044443098 8:92243574-92243596 AGCTGGGGCGGCTGGGACACAGG + Intergenic
1044606627 8:94053690-94053712 AGCTGGGTCTCCACTGAGACCGG - Intergenic
1045341430 8:101257986-101258008 AGCTGCAGCTCCAGGAAAGCTGG - Intergenic
1045367749 8:101492726-101492748 GGCTGAGGCTCCAGGAAAAGCGG + Exonic
1046012768 8:108570700-108570722 AGCTGGGCAACCAGGAAAACTGG + Intergenic
1046240619 8:111486194-111486216 AGCTGGGTCTCCAGGGCTACAGG - Intergenic
1046400957 8:113702915-113702937 AGCTGGAGCAGCTGGGAAACAGG + Intergenic
1048908941 8:139115862-139115884 AGCTGGCTCTACAGGGAAAAAGG + Intergenic
1048982531 8:139710521-139710543 AGCTGGGCCTCTAGGGCAGCAGG + Intergenic
1049541610 8:143211508-143211530 AGGCGGGGCACCAGGGAAGCGGG + Intergenic
1049693984 8:143974790-143974812 GGCTGGGGCTCCAGACAACCAGG + Intronic
1049796414 8:144499214-144499236 GCCTGGGGCTCCAGGGGAATGGG + Intronic
1052735631 9:32339380-32339402 AGCTGGAGAACCAGGGAAGCTGG - Intergenic
1052835390 9:33246362-33246384 ACCGGGGGCTCCAGAGACACAGG + Intronic
1052877077 9:33575368-33575390 ATCTGGGGCTGCAGGGCAGCTGG - Intergenic
1052878198 9:33583291-33583313 AGCTGGAGCTGCAGGGATGCAGG - Intergenic
1052879506 9:33592588-33592610 AGCTGGAGCTGCAGGGATGCAGG - Intergenic
1052879951 9:33595650-33595672 AGCTGGAGCTGCAGGGACGCAGG - Intergenic
1053496022 9:38548570-38548592 AGCTGGAGCTGCAGGGACGCAGG + Intronic
1053496472 9:38551644-38551666 AGCTGGAGCTGCAGGGATGCAGG + Intronic
1053497786 9:38560916-38560938 AGCTGGAGCTGCAGGGATGCAGG + Intronic
1053498928 9:38569026-38569048 ATCTGGGGCTGCAGGGCAGCTGG + Intronic
1053662269 9:40292273-40292295 ATCTGGGGCTGCAGGGCAGCTGG - Intronic
1053663392 9:40300250-40300272 AGCTGGGGCTGCTGGGATGCAGG - Intronic
1053664859 9:40310349-40310371 AGCTGGGGCTGCTGGGATGCAGG - Intronic
1053666174 9:40319474-40319496 AGCTGGAGCTGCAGGGATGCAGG - Intronic
1053912720 9:42922440-42922462 ATCTGGGGCTGCAGGGCAGCTGG - Intergenic
1053913903 9:42930791-42930813 AGCTGGGGCTGCTGGGATGCAGG - Intergenic
1053915759 9:42944521-42944543 AGCTGGAGCTGCAGGGATGCAGG - Intergenic
1054375515 9:64446484-64446506 AGCTGGGGCTGCTGGGATGCAGG - Intergenic
1054377327 9:64459502-64459524 AGCTGGAGCTGCAGGGATGCAGG - Intergenic
1054518435 9:66056809-66056831 AGCTGGAGCTGCAGGGATGCAGG + Intergenic
1054521222 9:66076035-66076057 AGCTGGGGCTGCTGGGATGCAGG + Intergenic
1054522341 9:66084011-66084033 ATCTGGGGCTGCAGGGCAGCTGG + Intergenic
1055834127 9:80419094-80419116 AGCTGGGGTTCCGGGGGAAGAGG + Intergenic
1056361280 9:85860317-85860339 AGCTGGGGAGGCAGGGATACAGG - Intergenic
1056610751 9:88124562-88124584 AGCTGGAGCTGCAGGGATGCAGG - Intergenic
1057106235 9:92420223-92420245 AGCTGAGGTTCCACGGAAATTGG - Intronic
1057552883 9:96065003-96065025 AGCCAGGGCTCCAGAGAAACAGG - Intergenic
1057675951 9:97136088-97136110 AGCTGGCGCTGCAGGGATGCAGG + Intergenic
1057676391 9:97139184-97139206 AGCTGGAGCTGCAGGGATGCAGG + Intergenic
1057677252 9:97145407-97145429 AGCTGGAGCTGCAGGGATGCAGG + Intergenic
1057677695 9:97148489-97148511 AGCTGGAGCTGCAGGGATGCAGG + Intergenic
1057678375 9:97153518-97153540 ATCTGGGGCTGCAGGGCAGCTGG + Intergenic
1057815595 9:98291708-98291730 AGCAGGGTTTCCAGGGAAACTGG - Intronic
1057921054 9:99097160-99097182 GGATGTGTCTCCAGGGAAACAGG + Intergenic
1058431763 9:104926830-104926852 AGATGGGGCTGCAGGGAACGTGG + Intronic
1058817101 9:108694543-108694565 AGCTGGGACTACAGGCACACAGG - Intergenic
1059386242 9:113966809-113966831 AGGTGGTGCTGCTGGGAAACTGG - Intronic
1059680561 9:116581387-116581409 AACTGGGGCACCAGGTAACCAGG - Intronic
1059960418 9:119559245-119559267 AGCTGGAGCCACAGGGAAAGGGG + Intergenic
1060188514 9:121578034-121578056 AGCCAGGGCACCAGGGAATCTGG + Intronic
1060253209 9:122002626-122002648 AGCTGAGCCTCCAGGGAATCTGG - Intronic
1060551536 9:124487761-124487783 AGCTGGGGCTCCAGGGAAACTGG - Intronic
1060799014 9:126532051-126532073 TGCTGAGCCTCCAGGGAGACAGG + Intergenic
1060824083 9:126677559-126677581 AGCTGGGGCCCCAGGTCAGCTGG - Intronic
1061243851 9:129391172-129391194 AGCTGAGGCTCTTGGGAAAATGG - Intergenic
1061305493 9:129730361-129730383 AGCTGTTGCTACAGGGAGACAGG - Intergenic
1061382194 9:130265433-130265455 AGTTGGGGCTGGAGGGAGACTGG + Intergenic
1061397790 9:130352938-130352960 ATCTGGGGCTCCAACGAGACAGG + Intronic
1061406713 9:130396293-130396315 ACCTGGGGCTCCTGGGATCCAGG - Intronic
1061647943 9:132021526-132021548 AGAGGGGGCTCCTGGGAGACAGG - Intronic
1061808660 9:133149847-133149869 AGATGGGGCTCAAGGGAGCCTGG + Intergenic
1062018485 9:134304408-134304430 AGCTGGGAGACCAGGGGAACAGG - Intergenic
1062481362 9:136754018-136754040 AGCTGGGGGTCCAGGGAGGCTGG + Intergenic
1062542806 9:137049048-137049070 AGCTCGGGTGCCAGGGCAACGGG - Exonic
1062567822 9:137171096-137171118 AGCTGGGACTCCACGTAAACCGG + Exonic
1062667266 9:137681675-137681697 AGCTGTGCCTCATGGGAAACTGG - Intronic
1185722599 X:2394322-2394344 AGCTGGGGCAGGAGGGAAATCGG + Intronic
1185742660 X:2546340-2546362 AGCTGGAGAACCAGGGAAACGGG + Intergenic
1186153494 X:6701301-6701323 GGATGGGGCTCCTGGGAAACAGG + Intergenic
1187533699 X:20118256-20118278 GCCTGGGGCTCCATGGGAACGGG - Intergenic
1188439144 X:30197435-30197457 AGCTGGAGAACCAGGAAAACAGG - Intergenic
1189073847 X:37894954-37894976 AGCTGGAGCACCAGGAAAGCTGG - Intronic
1189308952 X:40006741-40006763 CGGCGGGACTCCAGGGAAACAGG - Intergenic
1189381458 X:40505429-40505451 ACCTGGGGCTCCAGCCAACCAGG - Intergenic
1190123449 X:47683028-47683050 TGTTGGGGCTCCAGGGAATGTGG + Intergenic
1190425278 X:50329519-50329541 AGCTGGAGCTTCAGGGATGCGGG + Intronic
1193237869 X:79131125-79131147 AGCTGGAGCAGCAGGGATACAGG - Intergenic
1194797005 X:98224394-98224416 AGCTGAGGCTCCAGGAGAATTGG + Intergenic
1195980163 X:110568766-110568788 AGATGGGGTTGCAGGGAAAAGGG + Intergenic
1196525918 X:116727107-116727129 AGCTGGAGCAGCAGGGACACAGG - Intergenic
1197462061 X:126755113-126755135 ATCTGGGGCTCCAGGGACCGTGG - Intergenic
1197629506 X:128842059-128842081 AGCTGGAGAACCAGGGAAGCTGG - Intergenic
1197772773 X:130099988-130100010 AGAAGGGGCTCCAGGGCAAGTGG + Intronic
1198051608 X:132957396-132957418 AGCAGCGGCTCCAGGGGAAGGGG - Intronic
1198707198 X:139462194-139462216 AGCTGGAGCAGCTGGGAAACAGG - Intergenic
1198816072 X:140591738-140591760 AGCTGGGGCTGGAGGGAGACAGG + Intergenic
1199243444 X:145575131-145575153 AGCTGGGGCAGCAGGGATGCAGG - Intergenic
1199371425 X:147054344-147054366 AGCTGGAGATCTAGGGAAGCTGG + Intergenic
1199492493 X:148416300-148416322 AGCTTGGGCTCCAGGGAACTTGG - Intergenic
1200153061 X:153960821-153960843 AGCTGGGGCTCAAGGTGAGCCGG + Intronic
1201318135 Y:12668301-12668323 AGCTGGGGCTCCCAGGTTACTGG + Intergenic