ID: 1060552813

View in Genome Browser
Species Human (GRCh38)
Location 9:124493636-124493658
Sequence AGCCCTTGGTTTCTCCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 210}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060552813_1060552826 16 Left 1060552813 9:124493636-124493658 CCATGAGGGAGAAACCAAGGGCT 0: 1
1: 0
2: 0
3: 20
4: 210
Right 1060552826 9:124493675-124493697 GCAGAGCTCTCAGGCTCAGGAGG No data
1060552813_1060552823 7 Left 1060552813 9:124493636-124493658 CCATGAGGGAGAAACCAAGGGCT 0: 1
1: 0
2: 0
3: 20
4: 210
Right 1060552823 9:124493666-124493688 CGGGCCTACGCAGAGCTCTCAGG No data
1060552813_1060552825 13 Left 1060552813 9:124493636-124493658 CCATGAGGGAGAAACCAAGGGCT 0: 1
1: 0
2: 0
3: 20
4: 210
Right 1060552825 9:124493672-124493694 TACGCAGAGCTCTCAGGCTCAGG No data
1060552813_1060552830 26 Left 1060552813 9:124493636-124493658 CCATGAGGGAGAAACCAAGGGCT 0: 1
1: 0
2: 0
3: 20
4: 210
Right 1060552830 9:124493685-124493707 CAGGCTCAGGAGGAGGAGGGAGG No data
1060552813_1060552829 23 Left 1060552813 9:124493636-124493658 CCATGAGGGAGAAACCAAGGGCT 0: 1
1: 0
2: 0
3: 20
4: 210
Right 1060552829 9:124493682-124493704 TCTCAGGCTCAGGAGGAGGAGGG No data
1060552813_1060552827 19 Left 1060552813 9:124493636-124493658 CCATGAGGGAGAAACCAAGGGCT 0: 1
1: 0
2: 0
3: 20
4: 210
Right 1060552827 9:124493678-124493700 GAGCTCTCAGGCTCAGGAGGAGG No data
1060552813_1060552828 22 Left 1060552813 9:124493636-124493658 CCATGAGGGAGAAACCAAGGGCT 0: 1
1: 0
2: 0
3: 20
4: 210
Right 1060552828 9:124493681-124493703 CTCTCAGGCTCAGGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060552813 Original CRISPR AGCCCTTGGTTTCTCCCTCA TGG (reversed) Intronic
900766593 1:4509959-4509981 AGGCCTGGGTTTCACCCACAAGG - Intergenic
901306291 1:8235375-8235397 AGCCCGCGGTTTCTCTCTCATGG - Intergenic
902458421 1:16553209-16553231 AGCCCTTGAGGCCTCCCTCATGG - Intergenic
902493739 1:16854707-16854729 AGCCCTTGAGGCCTCCCTCATGG + Intronic
902530547 1:17087938-17087960 CCCCCTTGGTCTCTCCCACAGGG - Intronic
903151604 1:21413968-21413990 AGCCCTTGAGGCCTCCCTCATGG - Intergenic
903349038 1:22707134-22707156 AGCCCCTGGTGTCTCCATCTAGG + Intergenic
903350758 1:22715242-22715264 TCCCCTTGGTATCTCCCTCCAGG - Intronic
903813734 1:26049570-26049592 GGCCCTTGGCTTCTTGCTCATGG + Intergenic
904349845 1:29898163-29898185 AGCCCTGGGTTTCTCCAGCAGGG - Intergenic
905400163 1:37695800-37695822 AGCCCTTGGTCTAACCTTCAAGG - Intronic
905924200 1:41738317-41738339 AGCCCTGGGTTTCTCAATCCAGG + Intronic
906205359 1:43983724-43983746 AGCCCTGTGTCTCTCCCACATGG - Intronic
906431147 1:45756736-45756758 AGCCCTGGGTTTCTTCCCCCGGG + Intergenic
907417815 1:54326616-54326638 AGGCCTGCCTTTCTCCCTCATGG + Intronic
910218512 1:84865801-84865823 AACCGCTGGTTTCTCCGTCAGGG - Exonic
913320786 1:117587081-117587103 AGTCCTTGGCCTCTCCCTCTTGG - Intergenic
913607213 1:120477154-120477176 AGCCCTTGAGGCCTCCCTCATGG + Intergenic
914583979 1:149044684-149044706 AGCCCTTGAGGCCTCCCTCATGG - Intronic
915005394 1:152630409-152630431 AGGCCTGGGTCTCTCCCTCCAGG - Intergenic
916200055 1:162262676-162262698 ACCCCTTTGTTTCTCCTTAATGG + Intronic
916272438 1:162957736-162957758 ATCCCTCTCTTTCTCCCTCATGG - Intergenic
916564403 1:165960753-165960775 AGCCCATGATTTCTGCCCCAGGG - Intergenic
917653052 1:177097762-177097784 AGCCCTTTTTTTCTCACTGAAGG - Intronic
917669085 1:177255898-177255920 ATCCCTTGGCTTTTCCCCCAGGG + Exonic
920787802 1:209059389-209059411 AGCCCTCACTTTCTCCCTCCTGG - Intergenic
923829914 1:237543357-237543379 AACCCTTGTTTTCTCCCTTCTGG + Intronic
1062997616 10:1881732-1881754 AGCTCTTGGTTTCACCCACTGGG - Intergenic
1063615786 10:7599452-7599474 AGTTCTTGGTTTCTCACTCCTGG + Intronic
1064756818 10:18578824-18578846 AGCCCATAGTTTCTTCGTCATGG - Intronic
1065930285 10:30472992-30473014 TGCCCTTGGTTGCTCACTCATGG - Intergenic
1067938972 10:50636380-50636402 CGGCCTTGCTTTCTCCCTGACGG - Intergenic
1070156799 10:73840259-73840281 AGCCTTTGTTTTCTTTCTCAGGG - Intronic
1070957718 10:80475095-80475117 GGCCCTTGGCTCCTCCCACAGGG - Intronic
1071233391 10:83615568-83615590 GGCCCATGATTTCTCCCTCAGGG - Intergenic
1071777045 10:88800749-88800771 ACCCCATGAGTTCTCCCTCAAGG - Intergenic
1072685035 10:97531655-97531677 AGCCTTTGGTTAGTCCCCCAGGG + Intronic
1074095089 10:110304715-110304737 AGGCCTTACTCTCTCCCTCAGGG + Intronic
1075643723 10:124084220-124084242 AGCCCTTGGTACCTGCCTCTCGG + Intronic
1076597202 10:131631252-131631274 TGTCCTTGGTCTCTACCTCATGG - Intergenic
1077304607 11:1863510-1863532 GGACCTTGGTTTCTCCATCCTGG + Intronic
1077323680 11:1954066-1954088 AGCCCTTGCGTTCTTCCTCTGGG + Intronic
1078939410 11:15985230-15985252 AGCTCTTGGCTTCTCCTTTAAGG + Intronic
1083604658 11:63970919-63970941 AGCCCATGGTTTCTCTTCCATGG - Intergenic
1083623922 11:64062311-64062333 AGCCCTGGGTGTCTCCCAGAGGG + Intronic
1085509395 11:77080477-77080499 TGGCCTTGGCTTCTGCCTCAAGG + Intronic
1086857067 11:91878140-91878162 TGCCCTAGCTTTCACCCTCAAGG + Intergenic
1090082643 11:123624360-123624382 AGGCCTTGGTATTTCCCTAAGGG + Intronic
1090480617 11:127064783-127064805 ACCCAGTGGTTCCTCCCTCATGG + Intergenic
1202806667 11_KI270721v1_random:9261-9283 AGCCCTTGCGTTCTTCCTCTGGG + Intergenic
1091645552 12:2269881-2269903 TGACTATGGTTTCTCCCTCATGG - Intronic
1092904098 12:13086505-13086527 AGCTCTTACTTTCTCCCTTAAGG - Intronic
1096769660 12:53927046-53927068 CGCCCTTGGATTCTCACTCGGGG + Intergenic
1097090441 12:56500412-56500434 TGCCCTTGGTTTCCGACTCAGGG - Intergenic
1097708036 12:62888311-62888333 TCCCCTTGGCTTCTTCCTCATGG - Intronic
1099323606 12:81182398-81182420 ATCCCTTTGTTTCTCCTTGAAGG - Intronic
1101362649 12:104042320-104042342 AGCTCTTGACCTCTCCCTCATGG - Intronic
1101965448 12:109279233-109279255 AGCCCTTGAATTCATCCTCATGG - Exonic
1102654666 12:114471829-114471851 AGCACTGGGTTTCTCCCTGTTGG + Intergenic
1102944513 12:116974196-116974218 ATCCCTGGGGTTCTCCCTCTGGG - Intronic
1104426088 12:128679360-128679382 AAGCACTGGTTTCTCCCTCAGGG + Intronic
1106308572 13:28533869-28533891 AGCCCTTGATTTCTCCCACCTGG + Intergenic
1109864432 13:68244567-68244589 ATCCCTTTGTCTCTCCTTCAGGG + Intergenic
1111094884 13:83500143-83500165 CACTCTTGGTTTCTCCCTCCGGG + Intergenic
1112658098 13:101474224-101474246 AGGCCTTGGTCTCTCCCTTCAGG - Intronic
1113828321 13:113274091-113274113 TGGCCTTGGTTCCTCCATCACGG - Intergenic
1117376258 14:55120915-55120937 AGCCCTTGCATTATCCCTCTAGG + Intergenic
1118332452 14:64824925-64824947 AGGCCTTGGTTTTTCTCCCAAGG - Intronic
1119863575 14:77954821-77954843 TCCCTTTGGCTTCTCCCTCAAGG - Intergenic
1121909639 14:97777229-97777251 AGCCCATGGCTTCTTCCTCTGGG + Intergenic
1122092097 14:99347604-99347626 AGCCCTTGGTCTCTCCTTATGGG - Intergenic
1125728568 15:41880493-41880515 AGCCCTTGCCATCTCCCTCCAGG - Intronic
1126806960 15:52360672-52360694 AGCCCTCGGTTATTACCTCAGGG + Intronic
1128212020 15:65909510-65909532 GGCCCTGGTTTTCTCCCTTATGG + Intronic
1128554726 15:68623603-68623625 TGCCCTTGGCTTCTCCCACCAGG - Intronic
1131271080 15:90948057-90948079 AACCCTTGGTTTTTCCCCCTTGG + Intronic
1131536639 15:93242505-93242527 AGCCCCTGGGTGCTGCCTCATGG + Intergenic
1131754215 15:95542792-95542814 AGCCTTTGGGTACTTCCTCAGGG - Intergenic
1131764803 15:95663884-95663906 TGCCCTTGGTTTCCCCTTCTTGG - Intergenic
1136268966 16:29137312-29137334 AGCCCTTTGTTCCTGCTTCATGG + Intergenic
1136291098 16:29271927-29271949 GGCTCTTGGCCTCTCCCTCATGG + Intergenic
1136588876 16:31205058-31205080 AGCCCTTGGCTTGGCCTTCAAGG + Intergenic
1137668821 16:50267429-50267451 GGCCCTTGGCTTCCCCCTCCCGG - Intronic
1137705583 16:50533604-50533626 AGCTCTTGTTTTCTCCCTCTTGG - Intergenic
1138325695 16:56165184-56165206 AGCCATGGTTTCCTCCCTCAAGG + Intergenic
1138457969 16:57132191-57132213 AGACCTCAGTTTCTCCCTGAGGG + Intronic
1139227697 16:65249118-65249140 TGGCTTTGGTTCCTCCCTCAAGG - Intergenic
1141205889 16:81932837-81932859 AGCTCATGGTTCCTCCCCCATGG - Intronic
1141440981 16:84029401-84029423 AAACCTTGGTTTCTCTGTCAGGG - Intronic
1142072273 16:88097680-88097702 AGCCCTTTGTTCCTGCTTCATGG + Intronic
1143016893 17:3895564-3895586 AGCCCCTGCCATCTCCCTCAGGG - Intergenic
1143331964 17:6144088-6144110 AGCATGTGGTTTCTCCCTCATGG - Intergenic
1143381389 17:6498436-6498458 AGCCCCTGCTTTCTCTCCCATGG - Intronic
1144257945 17:13488433-13488455 AGCCATTGTTTTCTCTTTCATGG + Intergenic
1146978123 17:37133550-37133572 AACCATTGTTTTCTTCCTCAAGG + Intronic
1147837930 17:43348339-43348361 TGCCCTTGGTTTCTGACTGAGGG - Intergenic
1149080672 17:52652968-52652990 AGCTCTTATTCTCTCCCTCAAGG - Intergenic
1149545939 17:57504101-57504123 AGACTTTGGTTTCTCCTCCACGG + Intronic
1151358673 17:73575293-73575315 AAACCCTGGGTTCTCCCTCATGG + Intronic
1155708197 18:28842617-28842639 AGACCTTTTTTTCCCCCTCATGG + Intergenic
1157593300 18:48848819-48848841 GCACCTTGGTTTCTCCCTGAGGG + Intronic
1158542611 18:58370273-58370295 GGCCCTTGGTTACTCCTTCATGG + Intronic
1161684187 19:5695017-5695039 AGGCCCTGGTTTCACCATCAGGG - Intronic
1164393692 19:27846201-27846223 GGCCCTTGGTATCTCCCTTTCGG - Intergenic
1165160922 19:33815769-33815791 AGCCCTTGGTTTGTAATTCACGG + Intergenic
1166388403 19:42395352-42395374 GAGCCTTGGTTTCTCCCTAATGG + Intergenic
1167166919 19:47804769-47804791 CAGCCTTGGTTTCACCCTCATGG + Intronic
1167174915 19:47858995-47859017 CAGCCTTGGTTTCACCCTCATGG - Intergenic
1167813410 19:51855639-51855661 AGCTCTTGTTTGCTCCCTAACGG + Intergenic
1167853555 19:52220168-52220190 AACCCTTGGTTTCTCCTGTAGGG + Exonic
928118166 2:28563078-28563100 AGCCCTGGGTGACTCTCTCACGG + Exonic
929226704 2:39518252-39518274 AGCCTTTGTTTTCTTCCTCTGGG - Intergenic
931882727 2:66583264-66583286 GGCCCTCGGTTTCTCTCTCTGGG + Intergenic
932003959 2:67909444-67909466 AACCCAGGATTTCTCCCTCATGG + Intergenic
932463946 2:71901470-71901492 AGGTCTTGGTTTCTCACCCAAGG + Intergenic
932595225 2:73089183-73089205 AGACCTTGGCTTGTCCTTCATGG + Exonic
933025609 2:77253833-77253855 AGGCTTTGCTTTCTCCCTCCAGG - Intronic
933370937 2:81414702-81414724 CTCCTTTGGTTTTTCCCTCAGGG - Intergenic
933424168 2:82088693-82088715 AGCCATTGGCTTCACTCTCATGG - Intergenic
934609251 2:95722566-95722588 AGGCCTTGCTTCCACCCTCAAGG + Intergenic
935676481 2:105598663-105598685 AGCCCCAGGTTTCTGACTCAAGG + Intergenic
936453041 2:112647397-112647419 AACTATTGGTTTCTCCCTCGTGG + Exonic
936542576 2:113364143-113364165 AGGCCTCGCTTCCTCCCTCAAGG + Intergenic
936770460 2:115906681-115906703 AGCCATCGGTTTCTATCTCATGG - Intergenic
937084293 2:119160226-119160248 AGCCCTTAGATTCTCCCCCCAGG - Intergenic
939167003 2:138650845-138650867 AGCCCTTAGTTTCATTCTCATGG - Intergenic
939582610 2:143968332-143968354 AGCACTCAGTTTCCCCCTCAGGG - Intronic
940783637 2:157959281-157959303 AGCCCTTGGTGGCTCCCACAAGG - Intronic
941528684 2:166637682-166637704 ATCCCTTGGATTCTCATTCAGGG - Intergenic
943759882 2:191596432-191596454 AGTCCAAGGTTTGTCCCTCAAGG - Intergenic
944616368 2:201464966-201464988 AGGCCTGGGTTTCTCCCTTCAGG + Intronic
945322047 2:208435748-208435770 AGCCCTTGATTTTGGCCTCACGG + Intronic
946658827 2:221977673-221977695 AGCCTGTGGTTTCTGCCTGAAGG + Intergenic
947022966 2:225703844-225703866 ACTGCTTGGCTTCTCCCTCAAGG + Intergenic
948759534 2:240182206-240182228 GGCCCATGTGTTCTCCCTCAAGG + Intergenic
1168749922 20:275231-275253 AGTCCTTGGTCCCGCCCTCATGG - Intronic
1169059378 20:2650274-2650296 AACCTTTGGTTTCCCCTTCAAGG - Intergenic
1170794335 20:19533323-19533345 AGCCCCTGCTTTCTGCCTCTTGG - Intronic
1171491061 20:25517396-25517418 TGGCCTTGGTTTCAGCCTCAAGG - Intronic
1173401583 20:42730841-42730863 AGCTCCTGGGTTCTCCCACAGGG + Intronic
1175160697 20:57005520-57005542 AGCCATTAGATTCTCCCTCATGG - Intergenic
1175310643 20:58009408-58009430 ACCCCTTGGTTTCTACATAAGGG + Intergenic
1175988374 20:62775664-62775686 AGCCCTGGGTCTCTGCCTCAGGG + Intergenic
1181618712 22:24072666-24072688 TGTCCTTGGTTTCTCCCTGAGGG + Intronic
1182500598 22:30743925-30743947 AGCCTAAGGTTACTCCCTCAGGG - Intronic
1182774406 22:32820178-32820200 AGCCCTTCCTCACTCCCTCAGGG + Intronic
1184251514 22:43263034-43263056 TGCCCTTGCTTTCTCCCTAAGGG - Intronic
1184448786 22:44570636-44570658 AGCACTTTGTTTTTCCCTCAAGG - Intergenic
1185416701 22:50714647-50714669 TGCCCTGGTCTTCTCCCTCATGG + Intergenic
949361518 3:3237270-3237292 GACCCTTGCTTTCTTCCTCATGG + Intergenic
950447443 3:13046516-13046538 AGCCCTTGGTTGCTGTCTCCAGG + Intronic
950530112 3:13548464-13548486 CTCCCTTGGTTTGTCCCTCTTGG - Intergenic
951278934 3:20723254-20723276 AGACCTTGTTTTCTTCCACAGGG + Intergenic
951428852 3:22582971-22582993 TGCTCTTGGATTCTCCTTCAAGG - Intergenic
955219794 3:57013750-57013772 AGCACTTGGTGTCTAGCTCAGGG + Intronic
955694755 3:61624516-61624538 TGCCCTTGGGCTTTCCCTCATGG - Intronic
960950709 3:122996881-122996903 AGCCCCTGGTTTCTGTCTCCTGG + Intronic
961635037 3:128327952-128327974 AGCCTTTGGCTCCTTCCTCATGG - Intronic
963548994 3:146697191-146697213 AGCCCTGTGACTCTCCCTCAGGG + Intergenic
965795834 3:172437784-172437806 AGCCCTTGGCTCCTCTCCCAGGG - Intergenic
966718460 3:183037257-183037279 AGCCCTGGGTCTCATCCTCAAGG - Exonic
967975280 3:195030926-195030948 AGCCCTGCCCTTCTCCCTCAGGG - Intergenic
968703441 4:2067287-2067309 AGCCCTTGGCCCCTCCCTCCGGG - Exonic
968751576 4:2392241-2392263 AGGGGATGGTTTCTCCCTCAGGG - Intronic
969168852 4:5342462-5342484 ACACCTTGTTTTCTCACTCATGG + Intronic
970090853 4:12406348-12406370 AGACTTTGATTTCTCCCTGAAGG + Intergenic
972768373 4:42172559-42172581 AACCTTTGATCTCTCCCTCAGGG - Intergenic
973037457 4:45423991-45424013 AGCCATTGTTTTCTCCTTCCTGG + Intergenic
986324522 5:6662067-6662089 AGCCATTGCTGTCTGCCTCAGGG + Intronic
986629710 5:9759242-9759264 AGCCCATGGTTTCAGCCTCCTGG - Intergenic
986761256 5:10882125-10882147 AGACCAAGGTTTCTCCCTCTTGG + Intergenic
990294191 5:54383562-54383584 AGACCTTGGGTTATTCCTCAGGG - Intergenic
990574808 5:57114158-57114180 AGCTTTTTGTTTCTCCCTCATGG + Intergenic
990877783 5:60505787-60505809 GGTCCTTGGCTTCTCCCTTAGGG + Intronic
991596708 5:68314133-68314155 TGCCCTTGGTCTCTCCTTAATGG + Intergenic
993817968 5:92576562-92576584 AGCTCTTGACTTCTACCTCACGG + Intergenic
993965841 5:94359639-94359661 AGCCCACGGTCTCTGCCTCATGG - Intronic
994082044 5:95717733-95717755 AACCCTTTGTTTGTCCCTCCAGG - Intronic
995461594 5:112409709-112409731 AGACCTAGTTCTCTCCCTCAAGG + Intronic
995887175 5:116908571-116908593 ACCCCTGTGTTTCTCCTTCATGG + Intergenic
997882809 5:137605304-137605326 TCTCCTTGGTCTCTCCCTCAGGG - Intergenic
998265986 5:140668249-140668271 GCTCCTTGGTTTCTCCCTCTTGG - Exonic
1000013808 5:157259263-157259285 AGCACTTGGTTTGGGCCTCAAGG - Intergenic
1000373681 5:160560254-160560276 AGTCCAGGGTTCCTCCCTCATGG + Intergenic
1001203897 5:169744455-169744477 AGCTCTTGGTTTCAAACTCAGGG + Intronic
1002258929 5:177981108-177981130 AGCCCTGCCTTTCACCCTCAGGG - Intergenic
1003455821 6:6281309-6281331 AGACCTTGTCTTCTTCCTCAGGG + Intronic
1005417754 6:25619628-25619650 TGCCCTTGGTTCCTCTCTGATGG - Exonic
1006635427 6:35458141-35458163 AGCCCTTGGTTCCTTCCCCTAGG + Intronic
1007230396 6:40344016-40344038 AGCCCTTGGTTTCTGCATGAGGG + Intergenic
1007379179 6:41475963-41475985 AGCCTTTGTCTTCTCACTCACGG + Intergenic
1009481408 6:64162422-64162444 AGCCCTCTGTTTCTCCATCAAGG + Intronic
1010220414 6:73443847-73443869 AGCTCTTTTTTTCTGCCTCAGGG - Intronic
1011110001 6:83827387-83827409 GGCTCTTGGTTTCTGCCTCCAGG + Intergenic
1018502521 6:164426353-164426375 GGCCTTTGGTTTCTCCTTCTGGG + Intergenic
1020439402 7:8201497-8201519 TGCCTTTGGTTTTTCCCTCAGGG - Intronic
1021845445 7:24758018-24758040 AGCGCCTGGTTTTGCCCTCAAGG - Exonic
1023863560 7:44228599-44228621 AGCTCCTGGCTTCTCCCTAAGGG - Intronic
1024030075 7:45453579-45453601 AGCCCATGGCCTCTCCCTCCTGG - Intergenic
1024117281 7:46206212-46206234 AGTCACTGCTTTCTCCCTCAGGG - Intergenic
1024421112 7:49167811-49167833 CTTCCTTGGTTTCTCCCTCTTGG + Intergenic
1031212692 7:118850844-118850866 AGCTGTTTCTTTCTCCCTCAAGG - Intergenic
1032572962 7:133020882-133020904 AGCCCTGGGTTTCTCACTATTGG + Intronic
1032675235 7:134124154-134124176 ACCCCTTTGGTTCTCCCTCCAGG + Intergenic
1034927168 7:155131509-155131531 AGCCCTTGGATTGTCCCACCTGG - Intergenic
1035164949 7:156981496-156981518 GGCCTGTGGTTTCTCCCACAGGG - Intergenic
1036496692 8:9276688-9276710 AGCCTTGAGTTTCTCCATCATGG + Intergenic
1037476643 8:19264141-19264163 AGGTCTAGTTTTCTCCCTCAAGG + Intergenic
1043367725 8:79554713-79554735 AGCCCATGATTTCTCCCTTGGGG - Intergenic
1045168448 8:99634655-99634677 AGCCCTTGTTTTCTAGCTCTGGG + Intronic
1045719574 8:105092566-105092588 AGCCCTTGTTTTGTCCTCCAGGG + Intronic
1046323281 8:112606231-112606253 AGCCCATGATTTCTCCTACATGG + Intronic
1047517827 8:125570263-125570285 CGCCCTTGCTTTCTCCTCCAAGG + Intergenic
1053032585 9:34793976-34793998 AGCCCTGGTTTTCTCACTCCAGG + Intergenic
1060552813 9:124493636-124493658 AGCCCTTGGTTTCTCCCTCATGG - Intronic
1061241828 9:129378879-129378901 AGCCCTCGGTTTCCCCATCTGGG - Intergenic
1061626996 9:131846577-131846599 AGCATGTGGTTTCTACCTCAGGG + Intergenic
1061662070 9:132136822-132136844 AGCCCCTCCTTCCTCCCTCATGG + Intergenic
1061879646 9:133562395-133562417 AGCACTTGCTTTTTCCCTCCAGG - Intronic
1185477120 X:422002-422024 AGTCCTTCCTTTCTTCCTCAGGG - Intergenic
1186188479 X:7044905-7044927 AGCTCTTGGTTTTGCCTTCATGG + Intergenic
1188552032 X:31375020-31375042 GGCCCTAGGTCTCTCCCTGAGGG - Intronic
1190381840 X:49846837-49846859 TGACTTTGGTCTCTCCCTCAAGG - Intergenic
1192208483 X:69111406-69111428 ATCCTTTTGTTTCTTCCTCAGGG - Intergenic
1193358713 X:80555101-80555123 GGCCCATGATTTCTCCCTCAGGG + Intergenic
1193947005 X:87750805-87750827 AGCCTGTGGTTTCTCCCCCAGGG + Intergenic
1196975977 X:121158115-121158137 TGCCGTTAGCTTCTCCCTCAAGG - Intergenic
1197013114 X:121591253-121591275 AGTCCCTGGTTCCTACCTCATGG + Intergenic
1199924356 X:152447051-152447073 AGCCCTTTGCTTCTCTCTTATGG + Intronic
1199965086 X:152813044-152813066 AGCCCTTGTTCTCTTCATCATGG - Intergenic
1200049224 X:153419901-153419923 AGCCCTTCTTCTGTCCCTCAGGG + Intronic