ID: 1060552816

View in Genome Browser
Species Human (GRCh38)
Location 9:124493650-124493672
Sequence AGGCCCGGGGGGGAAGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 6, 3: 28, 4: 268}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060552816_1060552826 2 Left 1060552816 9:124493650-124493672 CCAAGGGCTTCCCCCCCGGGCCT 0: 1
1: 0
2: 6
3: 28
4: 268
Right 1060552826 9:124493675-124493697 GCAGAGCTCTCAGGCTCAGGAGG No data
1060552816_1060552825 -1 Left 1060552816 9:124493650-124493672 CCAAGGGCTTCCCCCCCGGGCCT 0: 1
1: 0
2: 6
3: 28
4: 268
Right 1060552825 9:124493672-124493694 TACGCAGAGCTCTCAGGCTCAGG No data
1060552816_1060552832 29 Left 1060552816 9:124493650-124493672 CCAAGGGCTTCCCCCCCGGGCCT 0: 1
1: 0
2: 6
3: 28
4: 268
Right 1060552832 9:124493702-124493724 GGGAGGTCCCACCTGGCCTGAGG No data
1060552816_1060552823 -7 Left 1060552816 9:124493650-124493672 CCAAGGGCTTCCCCCCCGGGCCT 0: 1
1: 0
2: 6
3: 28
4: 268
Right 1060552823 9:124493666-124493688 CGGGCCTACGCAGAGCTCTCAGG No data
1060552816_1060552829 9 Left 1060552816 9:124493650-124493672 CCAAGGGCTTCCCCCCCGGGCCT 0: 1
1: 0
2: 6
3: 28
4: 268
Right 1060552829 9:124493682-124493704 TCTCAGGCTCAGGAGGAGGAGGG No data
1060552816_1060552828 8 Left 1060552816 9:124493650-124493672 CCAAGGGCTTCCCCCCCGGGCCT 0: 1
1: 0
2: 6
3: 28
4: 268
Right 1060552828 9:124493681-124493703 CTCTCAGGCTCAGGAGGAGGAGG No data
1060552816_1060552830 12 Left 1060552816 9:124493650-124493672 CCAAGGGCTTCCCCCCCGGGCCT 0: 1
1: 0
2: 6
3: 28
4: 268
Right 1060552830 9:124493685-124493707 CAGGCTCAGGAGGAGGAGGGAGG No data
1060552816_1060552827 5 Left 1060552816 9:124493650-124493672 CCAAGGGCTTCCCCCCCGGGCCT 0: 1
1: 0
2: 6
3: 28
4: 268
Right 1060552827 9:124493678-124493700 GAGCTCTCAGGCTCAGGAGGAGG No data
1060552816_1060552831 22 Left 1060552816 9:124493650-124493672 CCAAGGGCTTCCCCCCCGGGCCT 0: 1
1: 0
2: 6
3: 28
4: 268
Right 1060552831 9:124493695-124493717 AGGAGGAGGGAGGTCCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060552816 Original CRISPR AGGCCCGGGGGGGAAGCCCT TGG (reversed) Intronic
900407732 1:2499831-2499853 AGGCCCGGGGAGGGGACCCTAGG - Intronic
900551613 1:3259263-3259285 AGCCCCTGGAGGGAATCCCTGGG - Intronic
901063726 1:6485371-6485393 AGTCCCGGAGGGGCAGCCCCGGG + Intronic
901192751 1:7422302-7422324 AGGCCCTGGATGGAAGCCCCCGG - Intronic
901305285 1:8228347-8228369 AGGTCAGCAGGGGAAGCCCTTGG + Intergenic
901490561 1:9594402-9594424 AGGCCCTGCGGGGAAGGCCCAGG - Intronic
901916560 1:12504869-12504891 CTGCCCGGATGGGAAGCCCTTGG + Intronic
902957339 1:19934537-19934559 AGGCCCGGGGGTGCCTCCCTAGG - Intergenic
902982734 1:20137635-20137657 TGTCCCAAGGGGGAAGCCCTAGG + Intergenic
903016883 1:20367063-20367085 AGGCCCGGGGAAGGAGCCCCAGG + Intergenic
903625110 1:24724854-24724876 GGGGCCTGGGGGGAACCCCTGGG + Intergenic
903735596 1:25528308-25528330 ATGCCCGGCGGGGAAGCCCTTGG + Intergenic
904446487 1:30576995-30577017 AGGCAGGTGGGGGCAGCCCTTGG - Intergenic
905358700 1:37403319-37403341 ATGCCTGGGTGGGAAGCCCCAGG - Intergenic
905884708 1:41485360-41485382 AGGCCCAGGAAGGATGCCCTTGG - Intergenic
905885208 1:41488081-41488103 AGGCCAGGGAGAGGAGCCCTAGG - Intergenic
906110315 1:43318097-43318119 AGGCCAGAGGGGGAAGCCACTGG + Intronic
908892835 1:68864770-68864792 AAGCCCGAGGGTGGAGCCCTTGG + Intergenic
909546574 1:76854675-76854697 AGGCCATGTGGGGAAGCACTAGG - Intergenic
914431105 1:147620672-147620694 CGGCCTGGGGCGGAAGCCCTTGG + Exonic
915314362 1:155019608-155019630 AGGCCCCTGGGGGCAGCCCAGGG - Intronic
915499069 1:156301938-156301960 AGGCCCGGGGCGCGAGGCCTGGG + Intergenic
915570131 1:156740866-156740888 AGGCTGGTGGGGGAAGCCTTTGG - Intronic
916470349 1:165117507-165117529 ACGGCCGGCGGGGAAGCACTGGG - Intergenic
916713387 1:167431460-167431482 AGGCCAGGGCCGTAAGCCCTGGG + Exonic
917944517 1:179955036-179955058 AGGCCAGGCCGGGCAGCCCTGGG + Exonic
918118451 1:181516967-181516989 AGGCCCTGGGGTGATGACCTTGG - Intronic
919755326 1:201062734-201062756 AGGCTGGGTGGGGAAGCCCTGGG - Intronic
920373031 1:205491730-205491752 CGGCCTCGGGGAGAAGCCCTAGG - Intergenic
920665386 1:207959441-207959463 AGGCCCCGGCGGGAGGCACTCGG - Intergenic
920702897 1:208231216-208231238 AGGCCGGGGAGGGAGGACCTAGG + Intronic
920765414 1:208828062-208828084 AGGCAGGGGAGGGAAACCCTGGG - Intergenic
921824791 1:219660690-219660712 AGGCCCCTGGGGGCAGCGCTGGG + Intergenic
922064891 1:222127050-222127072 AGGCCCGGGGAGGAAGTGTTTGG - Intergenic
922154677 1:223031633-223031655 AGTCCTGGGCTGGAAGCCCTAGG + Intergenic
923653198 1:235892757-235892779 AGGGTGGGGAGGGAAGCCCTGGG + Intergenic
1063377567 10:5563310-5563332 GGACCTGGGGGGGCAGCCCTGGG - Intergenic
1063995046 10:11611370-11611392 CGGCCCGGGGAGGACGCCCGCGG + Intronic
1064125713 10:12658473-12658495 AGGCCTGGGGGTGGAGCACTAGG - Intronic
1064410063 10:15097271-15097293 CGGGCCGGGGAGGAAGCGCTCGG - Exonic
1065189961 10:23199486-23199508 GCGGCCGGGAGGGAAGCCCTCGG + Intergenic
1069788329 10:71004005-71004027 AGGCCCACGGGGAAAGCCTTTGG - Intergenic
1070328935 10:75404609-75404631 AGGCTGGGGAGGGACGCCCTTGG - Intergenic
1071555992 10:86601975-86601997 AGGCCAGGGCGAGAAACCCTGGG + Intergenic
1071997617 10:91163162-91163184 GGGGCCGGGGGGGAGGCCCCGGG + Intronic
1072151664 10:92689649-92689671 ACGCCCTCGAGGGAAGCCCTGGG - Intergenic
1073432535 10:103495336-103495358 AAGCCAGGAAGGGAAGCCCTTGG + Intronic
1075279814 10:121129827-121129849 AGGCCGGGGGTAGAACCCCTGGG + Intergenic
1075633799 10:124017019-124017041 GCGCCCTGGGGGCAAGCCCTTGG - Intronic
1075743961 10:124713320-124713342 TGGCCTGGGGAGGAAGGCCTGGG - Intronic
1076650087 10:131981706-131981728 GGGCGCGGGGGGGAAGCCTGGGG - Intronic
1076674923 10:132142714-132142736 AGGCTCGGAGGGGAAGCCGCTGG + Intronic
1077080554 11:722894-722916 AGGGCTGGGGGGGGAGCTCTGGG - Intronic
1077328699 11:1974625-1974647 AGGCCCGGCAGGGCACCCCTCGG - Intronic
1077365589 11:2160257-2160279 AGGCCCTGGGGAGAAGTACTGGG - Intronic
1078414737 11:11156082-11156104 AGGCCCAGGGAGGAAGCCGAGGG - Intergenic
1082008962 11:47437826-47437848 GGGCCCAGGGGAGCAGCCCTGGG + Exonic
1083176225 11:60951804-60951826 AGGCGCGGGGAGGAAGCCTTAGG - Intronic
1083204430 11:61139613-61139635 AGGCCCAGGAGGGAACCCCAGGG + Intronic
1083667914 11:64285451-64285473 AGGCCCGGGGGCGGGGCCCGGGG + Intronic
1083774521 11:64887977-64887999 AGGCCTGGGGGAGCAGCCCCTGG - Intronic
1084090944 11:66879093-66879115 AGGGCCAGGGAGGAAGCCCCCGG + Intronic
1084209386 11:67614065-67614087 AGGCTCAGGGAGGAAGCCCGGGG + Intergenic
1084433464 11:69124041-69124063 AGGCCTGAGGTGGAGGCCCTGGG - Intergenic
1084470057 11:69354102-69354124 AGGCCCGGGGAGGGAGCTTTGGG + Intronic
1084564712 11:69922306-69922328 AGGCCAGCGGGGGGAGCCCAGGG + Intergenic
1085282757 11:75341710-75341732 AGCCCTGGGGAGGGAGCCCTCGG + Intronic
1085521813 11:77143564-77143586 GGGCCCGGAGGGGAAGCCCTGGG + Intronic
1089662119 11:119992547-119992569 AGGCCAAGCGGGGATGCCCTCGG - Intergenic
1090400872 11:126447470-126447492 AGCACCGGGTGGGAAACCCTGGG - Intronic
1091279417 11:134373637-134373659 GGGCCACGAGGGGAAGCCCTGGG - Intronic
1202811678 11_KI270721v1_random:29804-29826 AGGCCCGGCAGGGCACCCCTCGG - Intergenic
1091929515 12:4383565-4383587 AAGCCCAGGGAGGAGGCCCTGGG + Intergenic
1092140844 12:6182471-6182493 AGGCCTGGGTGGGAGGCCCCAGG + Intergenic
1092178301 12:6426365-6426387 AAGCCTGGGGGGGAAGTCCAAGG - Intergenic
1095741314 12:45609859-45609881 AGCCACGGTGGGGAACCCCTAGG + Intergenic
1095989967 12:48027750-48027772 AGGCTGGGGAGGGAAGGCCTTGG + Intergenic
1096216904 12:49802922-49802944 ACACCCTGGGGAGAAGCCCTGGG - Intronic
1097119843 12:56722889-56722911 GGGGGCGGGGGGGAAGCCCGTGG + Intronic
1098176043 12:67792439-67792461 AGGCACGGGAGGGAATCCCCTGG + Intergenic
1103764918 12:123272814-123272836 AGGCCTGGGTGGGCATCCCTAGG - Intergenic
1103850142 12:123927802-123927824 TGGCCCAGGAGGCAAGCCCTGGG + Exonic
1108093693 13:46878456-46878478 ATGCCGGGGGTTGAAGCCCTGGG + Intronic
1113662696 13:112118019-112118041 AGTGCCGCGGTGGAAGCCCTGGG + Intergenic
1114673880 14:24428861-24428883 GGGCCCGGGGGAGCAGCCCTGGG - Exonic
1116151317 14:41145554-41145576 TGGCCAGGTGGGCAAGCCCTTGG - Intergenic
1118024123 14:61751355-61751377 AGGCGTGGGGGGTCAGCCCTGGG + Intergenic
1118603754 14:67488379-67488401 AGGCCCCGGGGGGAGACCCAGGG - Intronic
1119617991 14:76111483-76111505 TGGCCAGGGGGTGAAGCCCTGGG + Intergenic
1119669164 14:76505775-76505797 AGGCACTGGGGGGAAGAACTTGG - Intergenic
1121442354 14:93957064-93957086 TGGCCCTTGGAGGAAGCCCTGGG + Intronic
1122801066 14:104229717-104229739 AGGCCCGGGGTGGAAACACCCGG - Intergenic
1122802627 14:104239278-104239300 AGGGCCTGAGGGGAAGCCCCGGG + Intergenic
1123122154 14:105921709-105921731 AGGCCTGGAGGGGAAGCACCAGG - Intronic
1123404821 15:20013274-20013296 AGGCCTGGAGGGGAAGCACCAGG - Intergenic
1123514152 15:21019922-21019944 AGGCCTGGAGGGGAAGCACCAGG - Intergenic
1124625839 15:31307028-31307050 AGGGCCTGGGGGGATGGCCTGGG + Intergenic
1126101349 15:45120042-45120064 AGGCCAGGGAGGGAGGGCCTGGG - Intronic
1128243118 15:66115048-66115070 AGGCCCGGGCGTGAAAGCCTTGG - Intronic
1128374392 15:67065336-67065358 GGGCGCGGGGAGGAAGTCCTGGG - Intronic
1128737384 15:70060839-70060861 AGTCCCCGGGGAGATGCCCTGGG + Intronic
1131484655 15:92809592-92809614 AGGCCCTGCGGGGAATCCCGCGG + Intronic
1131589288 15:93731016-93731038 AGGCACGGGAGGGAATCCCTTGG + Intergenic
1132637536 16:959701-959723 AGGCCCGGGGGGGAAAGCCCTGG - Intronic
1132749279 16:1449971-1449993 AGGCCCTGGCAGGAAGCCCCCGG - Intronic
1132940334 16:2503131-2503153 AGGCCCGGGTGGGGCCCCCTGGG - Exonic
1133018289 16:2954982-2955004 AGGCCCCGGGGGGCAGGCCAGGG + Intergenic
1134518151 16:14903690-14903712 AGGGCTGGGGGCCAAGCCCTGGG + Intronic
1134705822 16:16302344-16302366 AGGGCTGGGGGCCAAGCCCTGGG + Intergenic
1134961719 16:18409770-18409792 AGGGCTGGGGGCCAAGCCCTGGG - Intergenic
1134966017 16:18492369-18492391 AGGGCTGGGGGCCAAGCCCTGGG - Intronic
1136533940 16:30888089-30888111 GGGCCCGGGAGGCAAGCCCAGGG + Intronic
1136545093 16:30950032-30950054 ATGCCCGGGAGGGAACCGCTGGG + Intronic
1138120507 16:54397479-54397501 AGGACAGGGACGGAAGCCCTCGG - Intergenic
1139525888 16:67516263-67516285 AGGCCCTGGGGTGAGCCCCTAGG + Intergenic
1142247164 16:88975485-88975507 AGGCCCAGGGAGGAAGCACCCGG + Intronic
1142356269 16:89603574-89603596 GGGGCTGGAGGGGAAGCCCTGGG + Intergenic
1142356322 16:89603697-89603719 GGGGCTGGAGGGGAAGCCCTGGG + Intergenic
1142356341 16:89603736-89603758 GGGGCTGGAGGGGAAGCCCTGGG + Intergenic
1143181959 17:4988914-4988936 AGGCCCAGTGGGGCAGCTCTGGG - Exonic
1145941284 17:28744470-28744492 CGGCCCGGGGCGGAAGACCTCGG + Intronic
1146212651 17:30954320-30954342 AGGCCCCAGGGAGAAGCACTAGG + Intronic
1146638484 17:34523229-34523251 AGGGCAGGAGTGGAAGCCCTAGG + Intergenic
1147898704 17:43769561-43769583 AGGTCCGTGGGGGAGGCCGTGGG - Exonic
1147949527 17:44099263-44099285 AGGCTCTGGGGGAAAGCCTTGGG + Intronic
1149567669 17:57651496-57651518 AGGCCCGAGGGTGAAGCATTGGG - Intronic
1151682741 17:75630353-75630375 AGGCCTGGTGGGGTAGGCCTTGG + Intronic
1151713528 17:75819888-75819910 AGGCCCGGGGAGGACGGGCTGGG - Intronic
1151785425 17:76272698-76272720 AGCCCCGGGCGGGCACCCCTGGG - Intergenic
1152068606 17:78124508-78124530 AGGCGCGGTGAGGAAGCCCTAGG - Exonic
1152304016 17:79510842-79510864 AGGCCCCTGGTGGAAGCCCCAGG - Intronic
1152797536 17:82315567-82315589 AGGCTCTGCTGGGAAGCCCTGGG - Intronic
1153766924 18:8383901-8383923 AGGCCCCGGGGAGAGGCACTAGG - Intronic
1158082966 18:53615832-53615854 AGGCCACCTGGGGAAGCCCTGGG - Intergenic
1159955919 18:74518564-74518586 GGGCCACGGTGGGAAGCCCTGGG + Exonic
1160918761 19:1510241-1510263 AGCCCCTGGGGGGCAGTCCTAGG + Exonic
1161029409 19:2050888-2050910 AGGGCCCGGGGGGAGGCCCGAGG + Exonic
1161380049 19:3960013-3960035 AGGCCAAGGCGGGAAGCCCAGGG + Intronic
1161666158 19:5578299-5578321 GGGCCCGTGGGGGAAACGCTGGG + Intergenic
1162399299 19:10435188-10435210 AAGCCCTGGTGGGAAGGCCTAGG + Intronic
1162414023 19:10523586-10523608 GGGACCGGAGGGGAAGCCCAGGG - Intergenic
1162907087 19:13830522-13830544 AGGCCCGGAGCGGCAGCCCGCGG - Exonic
1163201157 19:15770139-15770161 AGGAGCTGGGGGGAAGACCTTGG - Intergenic
1163223263 19:15937001-15937023 AGGGCCAGGAGGGGAGCCCTGGG - Intergenic
1163402615 19:17103351-17103373 AGGCCACAGGGGGAAGCACTGGG + Intronic
1164557985 19:29268342-29268364 AGGCCCGCGGGGGAGGCTATGGG + Intergenic
1164687565 19:30177912-30177934 AGGCCCAGGAGTGGAGCCCTTGG + Intergenic
1164840862 19:31391199-31391221 AAGCCAGGGTGGGAGGCCCTGGG + Intergenic
1164992177 19:32692387-32692409 GGGCCTGGTGGGGAAGTCCTGGG - Exonic
1165093291 19:33397504-33397526 AGGCCCGTGGGGCAGGCCCTGGG - Intronic
1165110206 19:33497911-33497933 AGGCCTGGAGGGGAGGCCCCTGG + Intronic
1165143861 19:33719250-33719272 GGGCCGGGTGGGGGAGCCCTGGG + Intronic
1165157783 19:33798170-33798192 TGGCCCGGGGCGAAAGTCCTGGG - Intronic
1165396142 19:35564667-35564689 AGGCTCTGGGGTCAAGCCCTGGG - Intergenic
1165828487 19:38719012-38719034 AGGCCCGGGAAGGAGGCTCTGGG - Intronic
1165940929 19:39414343-39414365 AGGCCAGAGGGGGCAGCGCTGGG + Intronic
1167250503 19:48396366-48396388 AGGCCCAGGAGGGCAGCCCCCGG - Intronic
1168354769 19:55694400-55694422 AGGCCCGCGGGGGAAGGCAGCGG - Intronic
925067752 2:941884-941906 AGGCCCTGGAGGGAAGCACTGGG + Intergenic
926227901 2:10981379-10981401 GGGCCAGCGTGGGAAGCCCTAGG - Intergenic
927000963 2:18793791-18793813 AGGCCAGGGTAGGAGGCCCTGGG + Intergenic
927149470 2:20187445-20187467 TGGCCCTGGAGGGAAGCCCTGGG + Intergenic
927690449 2:25204440-25204462 GAGCCCGGTGGGGAGGCCCTGGG - Intergenic
927935376 2:27072859-27072881 AGCCACGGGGCTGAAGCCCTTGG - Intergenic
931739352 2:65228034-65228056 GGGCCCGGAGGTGCAGCCCTGGG - Intronic
932635595 2:73385689-73385711 AGGCCCGGCGGGAACGCCTTAGG - Intergenic
933187060 2:79290399-79290421 AGGGCCGGAGGTGGAGCCCTAGG - Intronic
934474775 2:94586833-94586855 AGGGGACGGGGGGAAGCCCTGGG - Intergenic
937317034 2:120938174-120938196 GGGTCCGGGGAGGAGGCCCTGGG - Intronic
938765904 2:134460316-134460338 AGGGCTGGGAGGGAGGCCCTGGG - Intronic
940639854 2:156334054-156334076 AGCCCCGCGGGAGAAGCCCTAGG - Intronic
941027135 2:160469336-160469358 AGCCCCAGGCGGGAAGCTCTGGG - Intronic
945253878 2:207787871-207787893 AGGACAGGGAGGGAAGCCCAAGG + Intergenic
946131661 2:217611362-217611384 AGGCCCCAGGGGGAAGGCCCAGG + Intronic
948398589 2:237665990-237666012 AGGACCGAGGGGGACGCCCCTGG - Intronic
948422684 2:237870249-237870271 AGGCCCTCGGGGCAGGCCCTGGG - Intronic
948571012 2:238917071-238917093 AGGCCCTGGTGGGGAGGCCTGGG - Intergenic
948643376 2:239388964-239388986 GGGCCTGTGGGAGAAGCCCTCGG - Intronic
948717155 2:239872236-239872258 AGTCCCCGGGGGGCAGCTCTTGG + Intergenic
949050688 2:241895937-241895959 GGGCCCGTGGGGCAAGCACTCGG + Intronic
1171020569 20:21581000-21581022 AGGGCTGGGGGGAAAGCCCAGGG - Intergenic
1172148953 20:32777327-32777349 AGGCCCTGGGGGAAGGCCCAGGG + Intronic
1172284673 20:33732220-33732242 AGGCCCGGCGGGGGAGCTCCGGG + Intronic
1173385341 20:42582279-42582301 AGGCCTGGGGTGGAGGCCCCTGG + Intronic
1173540065 20:43844383-43844405 AGGCCCTGGGGGCCAGCCCTTGG - Intergenic
1173655714 20:44698985-44699007 AGGCCCCGGGGTGAGGGCCTCGG + Intergenic
1174720062 20:52801969-52801991 AGGCATGGTGGGGAAGCCCAGGG + Intergenic
1175210365 20:57350466-57350488 AGGCCAGGGCGGGAAACCCGCGG + Intergenic
1175417416 20:58811009-58811031 AGGCCCTGGGGAGAGGACCTGGG - Intergenic
1175992027 20:62794444-62794466 GGGCCGGGCGGGGAAGCGCTCGG - Intergenic
1176190922 20:63809227-63809249 AGCCCTGGGGGCGCAGCCCTGGG + Intronic
1176382000 21:6118335-6118357 AGGCCCGGGGCGGGCGCACTGGG - Exonic
1176652862 21:9565980-9566002 AGGTCCCGGGGAGAAGTCCTGGG + Intergenic
1178633283 21:34280902-34280924 AGGCCCGGGTGAGAAACGCTTGG - Intergenic
1178985423 21:37298831-37298853 AGACCCTTGGGGGAAGCCTTAGG + Intergenic
1179741472 21:43419904-43419926 AGGCCCGGGGCGGGCGCACTGGG + Exonic
1180005493 21:45018779-45018801 GGGCCTGCGCGGGAAGCCCTGGG + Intergenic
1180156831 21:45982098-45982120 AGGCCCGGTGGGGCAGAGCTGGG - Intronic
1180867343 22:19127082-19127104 AGGCCAGGGGAGGATGCACTGGG - Intergenic
1181027019 22:20132310-20132332 AGGCCCTGGCGGGGAGCGCTGGG + Intronic
1181325080 22:22038701-22038723 AGGCCCAGGGGAGGAGCCCTGGG + Intergenic
1181574151 22:23783299-23783321 AGGGCTGAGTGGGAAGCCCTTGG - Intronic
1183437712 22:37805009-37805031 CCGCCCGGCGGGGAAGCCCAGGG + Intergenic
1183616412 22:38948493-38948515 GGGCCTGGGAGGGAAGCGCTGGG + Intergenic
1184007377 22:41720324-41720346 AGGCCCTAGGGTGAGGCCCTTGG + Intronic
1184570880 22:45324254-45324276 AGACCCGGGTGGGCAGCCCAAGG + Intronic
1185275843 22:49949953-49949975 GGGCCCTGGGGAGAAGTCCTTGG + Intergenic
950420984 3:12899357-12899379 AGGCGCCGGGGGGCAGTCCTCGG + Exonic
950650444 3:14403648-14403670 AGGCCCGGAGGGGCAGCCAAGGG + Intronic
952968517 3:38636409-38636431 AGGCCTGGTGAAGAAGCCCTAGG + Intronic
953947919 3:47164563-47164585 AGGCCTGGGGGAGGGGCCCTCGG - Intergenic
954296300 3:49676241-49676263 AGGCCCGGCAGGGCAGCCCTGGG + Intronic
954648442 3:52145299-52145321 AGGCCCAGGATGGTAGCCCTTGG - Intronic
959664599 3:108906378-108906400 AGGCCAGGGAGGGAAGCATTGGG + Intergenic
960876022 3:122296051-122296073 AGGACAGGGAGGGAAGCCCAAGG - Intergenic
962608747 3:137055154-137055176 AGACCAGGAGGGGAAGACCTTGG - Intergenic
963247291 3:143074953-143074975 GGGCCCAGGGGCCAAGCCCTGGG + Intergenic
964545633 3:157830426-157830448 AAGGCCGGGGGAGAAGGCCTTGG - Intergenic
967894346 3:194384382-194384404 AGGCCCGGAGGGGATGCCCTGGG + Intergenic
968077065 3:195821810-195821832 AGGCCCAGGGGGCGAGCCTTCGG + Intergenic
968648321 4:1750609-1750631 ACGCCCTGGGCAGAAGCCCTGGG - Intergenic
968652072 4:1764086-1764108 AGCCCAGCGGGGCAAGCCCTGGG - Intergenic
969074672 4:4568545-4568567 AGGCCTGGAGGGGAAGCTCCTGG - Intergenic
972532984 4:39977347-39977369 AGGCCCGGTGGGGCCGCCCGAGG - Intronic
981932703 4:150208163-150208185 AGGACAGGGAGGGAAGCCCAAGG + Intronic
982023390 4:151227938-151227960 AGGCCCTGGAGGGAAGCCCTTGG - Intronic
983098000 4:163588121-163588143 AGTCCCGGGGTGGAAGTGCTGGG + Intronic
985709123 5:1418272-1418294 AGGCCCAGGGAGGCAGCCATGGG - Intronic
986196061 5:5537159-5537181 AGGCCCTGGGGAAGAGCCCTTGG - Intergenic
988509490 5:31853834-31853856 AGTCCCGGGAGGGAGGCCCAGGG + Intronic
992940102 5:81752041-81752063 AGGCCGGGTGGGGAAGCCTGGGG - Intergenic
997201753 5:132013940-132013962 AGGCCAGGCTGGGGAGCCCTTGG + Intergenic
997319276 5:132964002-132964024 AGGCGAGGGGCGGAAGGCCTGGG - Intergenic
997518277 5:134506140-134506162 AGGCCCGGGGCAGAAGCCCTGGG - Intergenic
998505381 5:142668029-142668051 AGGCCCCTGGGGGAGGGCCTGGG + Intronic
999210438 5:149883668-149883690 AGGCCCAGGAGTGAAGACCTAGG + Intronic
1003614257 6:7641144-7641166 AGGCTCAGGGGGGCTGCCCTGGG + Intergenic
1004924345 6:20403357-20403379 GGGCCCGGCGAGGAAGGCCTGGG - Intronic
1005722607 6:28617502-28617524 AGGCCCAGGTGGGAGGCTCTTGG - Intergenic
1006898012 6:37483023-37483045 AGGCCAGGGAGGCAAGGCCTGGG + Exonic
1007825098 6:44594467-44594489 AGCCCCGGGAGGGTAGCCCTGGG + Intergenic
1013808737 6:114020588-114020610 AGGCCAGTTGGGGAGGCCCTGGG + Intergenic
1015116676 6:129657140-129657162 AGGCCCAGGTGGGAAGTCCTTGG + Intronic
1016856046 6:148671523-148671545 AGGCCCCGGGGGGAATCTCCTGG + Intergenic
1018583989 6:165335597-165335619 AGGCCTGGGATAGAAGCCCTTGG - Intronic
1018719692 6:166563280-166563302 AGGCCCCAGCGGGAAGCACTCGG + Intronic
1018864255 6:167735076-167735098 AGGTCGGTGGGGGAAGCCCTGGG - Intergenic
1019330052 7:457113-457135 AGGTCCGGGGTGGGAGACCTGGG - Intergenic
1019330139 7:457314-457336 AGGTCCGGGGTGGGAGACCTGGG - Intergenic
1019330194 7:457444-457466 AGGTCCGGGGTGGGAGACCTGGG - Intergenic
1019412554 7:912571-912593 AGGACCGGGGGAGAAGCCCTTGG - Intronic
1019513198 7:1428774-1428796 CGGCCCGGGGGGAAACACCTAGG + Intronic
1019518512 7:1450147-1450169 AGGGCCTGGGGGGAGTCCCTCGG + Intronic
1019620481 7:1989477-1989499 AGGCACGGGCTGGGAGCCCTCGG + Intronic
1019683601 7:2367316-2367338 GGTCCTGAGGGGGAAGCCCTTGG - Intronic
1020021980 7:4874576-4874598 AGGCCCAGGGGGCCAGCTCTGGG + Intronic
1020659520 7:10965900-10965922 AGGCACGGGAGGGAATCCCCTGG + Intergenic
1021521399 7:21542917-21542939 AGGCCGAGGGGAGAGGCCCTCGG - Intergenic
1022255305 7:28650582-28650604 AGGTTGGGGGGGGAAGCACTAGG - Intronic
1022976067 7:35557973-35557995 AGGTGCGGGAGGGAAGCCCAAGG - Intergenic
1024118336 7:46213426-46213448 AGGGCAGGGTGGGAAGGCCTAGG + Intergenic
1025279208 7:57614692-57614714 AGGTCCCGGGGAGAAGTCCTGGG + Intergenic
1025305523 7:57850808-57850830 AGGTCCCGGGGAGAAGTCCTGGG - Intergenic
1027174176 7:75892887-75892909 AGGCCGGGGTGGGAAGGGCTTGG + Intergenic
1029443578 7:100601116-100601138 AGGCCTGGTGTGGAAGCCTTGGG + Exonic
1029459581 7:100687240-100687262 AGGCCAGGGAGGGGAGGCCTGGG - Intronic
1029626322 7:101722352-101722374 AGGCCACGGCGGGAGGCCCTTGG - Intergenic
1034545204 7:151784795-151784817 AGGCCTGAGGAGGGAGCCCTAGG + Intronic
1034786956 7:153935022-153935044 AGGCCCGGGGGAGGAGCTCAGGG + Intronic
1035768798 8:2130131-2130153 AGGCGCGGTGGGGACGCCCTGGG - Intronic
1038335209 8:26640544-26640566 AGACCCAGGAGGGGAGCCCTGGG + Intronic
1038338059 8:26661398-26661420 GGGCCCGTGGGAGAAGCACTGGG + Intergenic
1044699035 8:94949618-94949640 AGGCCGGGGAGGGAAGCGCTGGG + Intronic
1049613695 8:143567356-143567378 GGGCCCGCGGGGGCAGCCCCGGG + Exonic
1053214335 9:36258249-36258271 AGGCCGGGGGAGGCGGCCCTGGG + Intronic
1053307813 9:36996254-36996276 AGGCCCTGGGGCCACGCCCTTGG + Intronic
1053840248 9:42184278-42184300 AGGCCCTGGTGGGAGGCCCTCGG - Intronic
1056338910 9:85604084-85604106 AAGCCCGGCTGGAAAGCCCTTGG + Intronic
1056583839 9:87915132-87915154 AGGCCCCGGTGGGAGGCCCTCGG - Intergenic
1056584331 9:87918601-87918623 AGGCCCCGGTGGGAGGCCCTCGG - Intergenic
1056612538 9:88134321-88134343 AGGCCCCGGTGGGAGGCCCTCGG + Intergenic
1056613030 9:88137789-88137811 AGGCCCCGGTGGGAGGCCCTCGG + Intergenic
1056817440 9:89811855-89811877 AGTCCCAGGTGGGGAGCCCTGGG + Intergenic
1057160118 9:92883216-92883238 AGGCCCCGGTGGGAGGCCCTTGG - Intergenic
1059451921 9:114376259-114376281 TGGCTAGGGTGGGAAGCCCTGGG - Intronic
1059451946 9:114376320-114376342 TGGCTGGGGTGGGAAGCCCTAGG - Intronic
1060552816 9:124493650-124493672 AGGCCCGGGGGGGAAGCCCTTGG - Intronic
1061296544 9:129679841-129679863 AGGCCCTGGAGGGGTGCCCTTGG - Intronic
1061680129 9:132238862-132238884 AGGGCCAGGTGGGAATCCCTGGG + Intronic
1061826292 9:133260361-133260383 AGGCCCCAGGGAGAGGCCCTGGG + Intronic
1061961551 9:133991581-133991603 GGGCGCGGGGCGGGAGCCCTCGG - Intronic
1061972774 9:134053808-134053830 AGGCACGGGAGGGAAGGCCTGGG + Intronic
1062138520 9:134942734-134942756 ATGCCCGGGGAGAAAGCCCATGG - Intergenic
1062375886 9:136261745-136261767 AGACCCGGGGGAGCAGCCTTTGG - Intergenic
1062449502 9:136609548-136609570 AGGCTCGGAGGGGAGGCCCCTGG + Intergenic
1203630591 Un_KI270750v1:69521-69543 AGGTCCCGGGGAGAAGTCCTGGG + Intergenic
1185448507 X:271000-271022 AGGCCGGGCACGGAAGCCCTTGG - Intergenic
1186515372 X:10163064-10163086 AGGTCTGGGGGTGAAGCCCAGGG + Intronic
1187365378 X:18661994-18662016 AGGCCTGGGGGTGGAGCCCGAGG + Intronic
1188882983 X:35513308-35513330 AGGCCTGAAGGGGAAGGCCTCGG + Intergenic
1196167483 X:112551567-112551589 AGGCACGGGAGGGAATCCCCTGG + Intergenic
1199851185 X:151725815-151725837 AGGCCAGGAGGGGAAGACCAGGG - Intergenic
1200155130 X:153971141-153971163 AAGCTCGGGCGGGAGGCCCTGGG + Exonic