ID: 1060552817

View in Genome Browser
Species Human (GRCh38)
Location 9:124493660-124493682
Sequence AGCTCTGCGTAGGCCCGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 130}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060552817_1060552826 -8 Left 1060552817 9:124493660-124493682 CCCCCCCGGGCCTACGCAGAGCT 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1060552826 9:124493675-124493697 GCAGAGCTCTCAGGCTCAGGAGG No data
1060552817_1060552827 -5 Left 1060552817 9:124493660-124493682 CCCCCCCGGGCCTACGCAGAGCT 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1060552827 9:124493678-124493700 GAGCTCTCAGGCTCAGGAGGAGG No data
1060552817_1060552833 24 Left 1060552817 9:124493660-124493682 CCCCCCCGGGCCTACGCAGAGCT 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1060552833 9:124493707-124493729 GTCCCACCTGGCCTGAGGTCAGG No data
1060552817_1060552828 -2 Left 1060552817 9:124493660-124493682 CCCCCCCGGGCCTACGCAGAGCT 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1060552828 9:124493681-124493703 CTCTCAGGCTCAGGAGGAGGAGG No data
1060552817_1060552830 2 Left 1060552817 9:124493660-124493682 CCCCCCCGGGCCTACGCAGAGCT 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1060552830 9:124493685-124493707 CAGGCTCAGGAGGAGGAGGGAGG No data
1060552817_1060552829 -1 Left 1060552817 9:124493660-124493682 CCCCCCCGGGCCTACGCAGAGCT 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1060552829 9:124493682-124493704 TCTCAGGCTCAGGAGGAGGAGGG No data
1060552817_1060552831 12 Left 1060552817 9:124493660-124493682 CCCCCCCGGGCCTACGCAGAGCT 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1060552831 9:124493695-124493717 AGGAGGAGGGAGGTCCCACCTGG No data
1060552817_1060552832 19 Left 1060552817 9:124493660-124493682 CCCCCCCGGGCCTACGCAGAGCT 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1060552832 9:124493702-124493724 GGGAGGTCCCACCTGGCCTGAGG No data
1060552817_1060552837 30 Left 1060552817 9:124493660-124493682 CCCCCCCGGGCCTACGCAGAGCT 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1060552837 9:124493713-124493735 CCTGGCCTGAGGTCAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060552817 Original CRISPR AGCTCTGCGTAGGCCCGGGG GGG (reversed) Intronic
900210257 1:1452126-1452148 AGCGCTGCCGAGGCCCGGGCCGG + Intronic
900216064 1:1482307-1482329 AGCACTGCCCAGGCCCGGGCCGG + Intronic
900223185 1:1520310-1520332 AGCACTGCCGAGGCCCGGGCCGG + Intronic
901054150 1:6440807-6440829 AGGTCAGCGCGGGCCCGGGGTGG + Exonic
901395166 1:8975851-8975873 ATCTCTTCCTAGGCCAGGGGTGG - Intergenic
902480160 1:16707524-16707546 AGGTCAGCGCGGGCCCGGGGTGG - Intergenic
903945652 1:26960510-26960532 AGCTCTGCAGAGCCCCGGGGCGG - Intergenic
903980921 1:27187647-27187669 AGCTCTTTGAAGGCCAGGGGTGG - Intergenic
915303097 1:154962452-154962474 GGCCCAGCCTAGGCCCGGGGTGG - Exonic
915650600 1:157307650-157307672 AGCTCTGGGGAGGGCAGGGGAGG - Intergenic
920572449 1:207027727-207027749 GGCTCTGCCCAGGCCCTGGGCGG + Intronic
921993807 1:221395915-221395937 AGCTCTGAAGAGGCCCCGGGAGG + Intergenic
924453825 1:244201988-244202010 TGCTCTGTGTAGGCCTGGGCAGG - Intergenic
1065529401 10:26653271-26653293 AGCTCTGGGTACTCCAGGGGCGG - Intergenic
1069381687 10:67848918-67848940 AGCTCTGTGGAGGCCGGGCGCGG + Intergenic
1069749397 10:70735856-70735878 AGCTCAGCCTGGGCCCTGGGTGG - Intronic
1070813953 10:79311852-79311874 AGCTCTGTGTAGGCATGGGCGGG - Intronic
1074456636 10:113601254-113601276 AGCTCTGGGTAGGGCCAGAGGGG - Intronic
1075287736 10:121201784-121201806 AGCTCTGGGAAGGCCCCTGGTGG - Intergenic
1076401596 10:130188942-130188964 CGCTGTGCTTAGGCCTGGGGTGG + Intergenic
1078610446 11:12814754-12814776 AGCTCTGCGATGGTCAGGGGTGG - Intronic
1080386306 11:31813037-31813059 ACCTCTGGCTAGGGCCGGGGAGG - Intronic
1082002338 11:47400147-47400169 CGCTCTGGGGAGGCCGGGGGCGG + Intergenic
1082978907 11:59102570-59102592 AGCACCGCGGACGCCCGGGGAGG + Intergenic
1083433487 11:62627221-62627243 AGCACTGCGGATGCCCAGGGAGG - Intronic
1084483587 11:69435498-69435520 AGCTCGGGGCAGGCACGGGGTGG + Intergenic
1089398250 11:118149725-118149747 ATCTCTGCATAAGCCAGGGGTGG - Intronic
1091703793 12:2680404-2680426 AGCCCTGCGGGGGCCCAGGGCGG - Intronic
1097042293 12:56163112-56163134 AGCTCAGCGTAGGGTGGGGGAGG + Intronic
1101568554 12:105932509-105932531 AGCTCTGAGTAGGCGGGGTGGGG + Intergenic
1104449039 12:128854242-128854264 AGCCCGGCGGGGGCCCGGGGAGG + Intronic
1105699542 13:22926232-22926254 AGCTCTGCGTGGGCCGGTCGTGG - Intergenic
1109428136 13:62194599-62194621 AGCTCTGAGTAGGCCAGAGAAGG - Intergenic
1114655205 14:24311592-24311614 GGCTCTGGGGAGGCCCGAGGGGG + Exonic
1118218560 14:63832925-63832947 AGCTCTCGGGAGGCCCTGGGAGG + Intergenic
1122208382 14:100159666-100159688 AGCTCTGATTAGGGCGGGGGCGG + Exonic
1122343785 14:101045624-101045646 AGCTCTGCGTGTGCCCAGGAAGG + Intergenic
1122414104 14:101540639-101540661 AGCACTGAGTAGGACCAGGGAGG + Intergenic
1122885841 14:104709929-104709951 TGCTCTGCGCAGGCCCGGGAGGG + Intronic
1123047732 14:105526878-105526900 AGCTCTGCACCGGCCCGCGGCGG + Intronic
1128752751 15:70160900-70160922 GGCTCTGAGGAGGCCAGGGGAGG + Intergenic
1129857563 15:78835493-78835515 AGCTGGGCGTAGGCCAGGAGTGG - Intronic
1133037259 16:3040626-3040648 ACCTCAGGGAAGGCCCGGGGAGG + Intergenic
1134018792 16:10907449-10907471 AGCTCTGCCAGGGCCCCGGGGGG - Exonic
1135641785 16:24125953-24125975 AGCTCTGAGTATCCCTGGGGTGG + Intronic
1138217249 16:55214913-55214935 AGGTCTGAGTAGACGCGGGGTGG - Intergenic
1143037625 17:4008755-4008777 AGCTCTGTGTAAGCTCCGGGTGG + Intronic
1143954588 17:10658406-10658428 AGGTCTGCGTGGGACCGGGGAGG + Intergenic
1147972532 17:44227119-44227141 AGCCCTGCCTAGGCCCGGAGTGG - Intergenic
1148090994 17:45022334-45022356 AGCTCTGGCGAGGCCCGGGCAGG + Intergenic
1148760352 17:49996723-49996745 AGCACTGCGTTCGCCCGGCGAGG - Intergenic
1151360992 17:73588764-73588786 CGCTGTGCCTAGGGCCGGGGCGG + Intronic
1151581628 17:74982469-74982491 AGCGCCGCTTAGGCGCGGGGCGG - Intergenic
1151866818 17:76809022-76809044 ATCTCTGAGTAGGCCAGGTGTGG + Intergenic
1152804634 17:82349394-82349416 AGCTCTGCACAGCCCGGGGGAGG + Intergenic
1153048328 18:877157-877179 AGCTCTGTGGAGGCCCTGGAGGG + Intergenic
1155159703 18:23185586-23185608 AGCCCTGGGGAGGCCCTGGGTGG - Intronic
1157578466 18:48759296-48759318 AGCTCTGCGGAAGCCCCAGGAGG - Intronic
1160857904 19:1225692-1225714 AGCTCTGGGGCAGCCCGGGGCGG + Intronic
1160955272 19:1688380-1688402 AGCTCTGCCTGGGATCGGGGAGG + Intergenic
1160994396 19:1875998-1876020 AGTTCCTCGTAGGCCCGTGGGGG - Intergenic
1161069267 19:2252335-2252357 AGCTCCGCGCAGGCAAGGGGCGG - Exonic
1162985073 19:14264716-14264738 AGGTCTGCGCAGGCCGGGCGCGG - Intergenic
1163782697 19:19258635-19258657 AGCCCTGCGGCGGCCTGGGGGGG - Exonic
925626003 2:5842509-5842531 AGTTCAGCCTAGGGCCGGGGCGG - Intergenic
926154946 2:10448457-10448479 AGCTCCGCGCGGGCCCGGGTTGG - Exonic
928433428 2:31238830-31238852 AGCTCTGCCAAGGTCCAGGGAGG - Intronic
930237661 2:48903299-48903321 AGGTCTTCGTGGGCCCTGGGAGG - Intergenic
931671216 2:64649817-64649839 AGCTATGCGGAGGCGTGGGGTGG - Intronic
936043895 2:109171594-109171616 AGCTCTGCACAGACCAGGGGCGG - Intronic
936431682 2:112470340-112470362 AACTCTGTGTAGGCCGGGCGCGG + Intergenic
937632601 2:124120253-124120275 AGCTCAGCCTAGGCTCTGGGAGG - Intronic
938257827 2:129873834-129873856 AGCTCTGTGGAGGCCCTGGTGGG - Intergenic
947353656 2:229271373-229271395 CGCTCTGAGCATGCCCGGGGCGG + Intergenic
947729792 2:232421373-232421395 AGCTCTGCGCAGGCGCTGTGCGG - Intergenic
948570018 2:238912164-238912186 TGCTCTGCTGAGGCCCGTGGAGG + Intergenic
948717089 2:239871998-239872020 GGCTCTGAGTAGGGCTGGGGGGG - Intergenic
948805960 2:240453512-240453534 AGGGCTGCGACGGCCCGGGGAGG - Intronic
1171407056 20:24918444-24918466 AGCTTTCCGTAGGCCCCGGCTGG - Intergenic
1171974693 20:31587131-31587153 AGCTGGGCGTAGGCCGGGCGCGG - Intergenic
1174284269 20:49461215-49461237 AGCTCTGCCAAGCCCCTGGGGGG - Intronic
1180030159 21:45201312-45201334 AGCTCTGCAGAGGCCCTGGGTGG - Intronic
1181109261 22:20591751-20591773 AGACCCGCCTAGGCCCGGGGCGG - Intergenic
1181307023 22:21922815-21922837 AGCTCCTATTAGGCCCGGGGTGG - Exonic
1181945281 22:26512253-26512275 AGCTCTGCCGAGGCACGGAGAGG - Intronic
1183041700 22:35184820-35184842 AGCTCTGCGGGGGGCTGGGGAGG - Intergenic
1183319345 22:37155705-37155727 AGGTCTGGGTAGGCCCGAGTGGG - Intronic
1184692288 22:46122838-46122860 AGCTCTGTGCCCGCCCGGGGGGG - Intergenic
1185413962 22:50699760-50699782 AGCTCAGCAGAGGCCCAGGGAGG + Intergenic
950012082 3:9731276-9731298 AGTTATGGGTAGGACCGGGGCGG - Intergenic
950100968 3:10356621-10356643 AGCTCTGGGAGGGCCCGGGAAGG + Intronic
954151010 3:48657076-48657098 AGCTCCACGTGGGGCCGGGGCGG - Exonic
954300424 3:49698159-49698181 AGCTCTCCCTGGGCCCAGGGAGG - Intronic
954792328 3:53142557-53142579 AGCTCTGCGTAGGTCAAGGCTGG - Intergenic
956643002 3:71432329-71432351 TGCTCTGTGCAGGGCCGGGGAGG - Intronic
956989942 3:74751566-74751588 AGCTCAGAGTAGGCCCTGGAAGG + Intergenic
961451548 3:127004510-127004532 TGCTCTCCTTAGGCCCGGGGAGG - Intronic
967925151 3:194640078-194640100 AGCTCTGCAGAGGCCCTTGGAGG + Intergenic
968514660 4:1011183-1011205 ACCTCTGCGCAGCCCCGGGCCGG - Exonic
969363966 4:6683137-6683159 AGCTCTGCAAAGGCCAAGGGTGG - Intergenic
976805206 4:89038125-89038147 AGCTCTGCGAGGGCCCAAGGGGG + Intronic
980187419 4:129479618-129479640 AGCTTTCCGTAGGCCAGGTGCGG - Intergenic
980928401 4:139161678-139161700 AACTCTGAGTAGGCCGGGCGCGG + Intronic
980970194 4:139560210-139560232 AGTTCTGCGGGGGCCGGGGGGGG + Intronic
980990458 4:139734928-139734950 TGCTCTGCGTTGCCCCGGCGAGG - Intronic
985529989 5:428481-428503 AGCTGTGGGTAGGCCTGGGTTGG - Intronic
985774572 5:1834074-1834096 AGCTCTGCAGACGCCCAGGGAGG - Intergenic
992291451 5:75283809-75283831 AGCACTCCCTTGGCCCGGGGTGG - Intergenic
998429659 5:142060057-142060079 ACCCCTGCATAGGCCCTGGGAGG + Intergenic
1001692335 5:173642434-173642456 GGCTCTGCGTGGGCACAGGGTGG + Intergenic
1007179191 6:39916017-39916039 AGCTATGTGCAGGCCCTGGGAGG + Intronic
1019433413 7:1010116-1010138 AGCTGTGCTCAGGCCCGGGCTGG - Exonic
1019578828 7:1750231-1750253 AGCTCTGTGTGGGCGCAGGGAGG + Intergenic
1020017562 7:4840300-4840322 AGCTCTGTGCAGACCCAGGGCGG + Intronic
1021670676 7:23032155-23032177 GGCTCTGCTTAGGCCGGGCGCGG - Intergenic
1022097684 7:27151078-27151100 TGCTCTGCGTGCGCTCGGGGCGG - Intronic
1029381736 7:100219704-100219726 AGCCCTGGCTAGGCCTGGGGAGG - Exonic
1029731614 7:102442123-102442145 ACCTCTGCATAGGCCAGGCGGGG + Intronic
1032677535 7:134145188-134145210 AGCTCTGTGTAGACCTGGGAAGG + Intronic
1034979335 7:155466422-155466444 AGCTCAGCCTGGGCCCGGCGGGG - Intergenic
1039053270 8:33514008-33514030 AGCTCTGCATTGGCCAGGCGCGG - Intergenic
1039914015 8:41846419-41846441 AGCTCTGCCAAGGCCCGTGTGGG + Intronic
1040106841 8:43546349-43546371 AGCCCTGCGTCGGACCCGGGGGG - Intergenic
1040932251 8:52747474-52747496 AGCTCTGAGTATGAGCGGGGTGG - Intergenic
1043172069 8:76978334-76978356 AGCTCTGAGGAGGCCAGAGGAGG - Intergenic
1045714398 8:105024865-105024887 ATCTCTGCTTAGTCCCGGGGTGG - Intronic
1047292440 8:123541657-123541679 AGCTCTGCGGACGGCCCGGGAGG - Intergenic
1048867533 8:138771838-138771860 AGCTCTCCGCAGGCCCCGGGGGG - Intronic
1049557929 8:143292705-143292727 TGCTCTGCGTCAGCCCTGGGTGG + Intronic
1049581128 8:143411464-143411486 AGCCCTGGGTAGGGCCTGGGGGG + Intergenic
1050377247 9:4985539-4985561 AGGTCTGCGAAGCCCCGGGACGG - Exonic
1055998642 9:82190714-82190736 AGATTTGCGAAGGGCCGGGGTGG + Intergenic
1060468551 9:123929602-123929624 GGCTCTCCGTAAACCCGGGGAGG + Intronic
1060552817 9:124493660-124493682 AGCTCTGCGTAGGCCCGGGGGGG - Intronic
1061379194 9:130243943-130243965 AGCTCTGGGTGTGCCCGGGCTGG - Intergenic
1062226976 9:135457745-135457767 AGCTCAGCTAAGGCCCGGAGGGG + Intergenic
1062280063 9:135747807-135747829 AGCCCTGAGTATGCCCGGTGGGG + Intronic
1198705832 X:139447120-139447142 CGCGCTGCGGAGGCGCGGGGTGG - Intergenic
1200053385 X:153446236-153446258 AGCTCTTCACAGGCACGGGGAGG + Intronic