ID: 1060552818

View in Genome Browser
Species Human (GRCh38)
Location 9:124493661-124493683
Sequence GAGCTCTGCGTAGGCCCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060552818_1060552838 30 Left 1060552818 9:124493661-124493683 CCCCCCGGGCCTACGCAGAGCTC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1060552838 9:124493714-124493736 CTGGCCTGAGGTCAGGCCCAGGG No data
1060552818_1060552837 29 Left 1060552818 9:124493661-124493683 CCCCCCGGGCCTACGCAGAGCTC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1060552837 9:124493713-124493735 CCTGGCCTGAGGTCAGGCCCAGG No data
1060552818_1060552830 1 Left 1060552818 9:124493661-124493683 CCCCCCGGGCCTACGCAGAGCTC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1060552830 9:124493685-124493707 CAGGCTCAGGAGGAGGAGGGAGG No data
1060552818_1060552828 -3 Left 1060552818 9:124493661-124493683 CCCCCCGGGCCTACGCAGAGCTC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1060552828 9:124493681-124493703 CTCTCAGGCTCAGGAGGAGGAGG No data
1060552818_1060552832 18 Left 1060552818 9:124493661-124493683 CCCCCCGGGCCTACGCAGAGCTC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1060552832 9:124493702-124493724 GGGAGGTCCCACCTGGCCTGAGG No data
1060552818_1060552827 -6 Left 1060552818 9:124493661-124493683 CCCCCCGGGCCTACGCAGAGCTC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1060552827 9:124493678-124493700 GAGCTCTCAGGCTCAGGAGGAGG No data
1060552818_1060552833 23 Left 1060552818 9:124493661-124493683 CCCCCCGGGCCTACGCAGAGCTC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1060552833 9:124493707-124493729 GTCCCACCTGGCCTGAGGTCAGG No data
1060552818_1060552829 -2 Left 1060552818 9:124493661-124493683 CCCCCCGGGCCTACGCAGAGCTC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1060552829 9:124493682-124493704 TCTCAGGCTCAGGAGGAGGAGGG No data
1060552818_1060552831 11 Left 1060552818 9:124493661-124493683 CCCCCCGGGCCTACGCAGAGCTC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1060552831 9:124493695-124493717 AGGAGGAGGGAGGTCCCACCTGG No data
1060552818_1060552826 -9 Left 1060552818 9:124493661-124493683 CCCCCCGGGCCTACGCAGAGCTC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1060552826 9:124493675-124493697 GCAGAGCTCTCAGGCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060552818 Original CRISPR GAGCTCTGCGTAGGCCCGGG GGG (reversed) Intronic
900995668 1:6122011-6122033 CAGCTCTGAGAAGCCCCGGGAGG + Intronic
901232993 1:7651617-7651639 GAGATCTGCCCAGGCCAGGGTGG - Intronic
902858350 1:19225727-19225749 GAGGACTGCTTAAGCCCGGGAGG + Intronic
903364906 1:22800112-22800134 GAGCTCCCCGGAGACCCGGGAGG + Intronic
903545945 1:24123463-24123485 GGGCTCTGCCTGGGCCCGGTTGG + Intronic
903872858 1:26449488-26449510 GAGGACTGCTTGGGCCCGGGAGG - Intronic
906248653 1:44294621-44294643 GAGCTCTGGCCAGGCCCTGGTGG - Intronic
908938129 1:69400156-69400178 GAGCTCTGTGGAGGCCAGTGTGG - Intergenic
910883028 1:91939573-91939595 GAGAACTGCTTAAGCCCGGGAGG - Intergenic
1065764552 10:29015652-29015674 CAGCTCTCTGTAGGCCTGGGAGG - Intergenic
1065979230 10:30875134-30875156 GAGCTCTGGGTAGGGCCAAGGGG + Intronic
1067164676 10:43855883-43855905 GAGCTCTGCCCAGGCCAGGCTGG - Intergenic
1069015584 10:63425690-63425712 GAGGACTGCTTAGGCCCAGGAGG + Intronic
1070813954 10:79311853-79311875 CAGCTCTGTGTAGGCATGGGCGG - Intronic
1072067790 10:91887329-91887351 GAGCTCAGGGCCGGCCCGGGAGG + Intergenic
1074182902 10:111078807-111078829 GAGCGCAGCGCGGGCCCGGGGGG + Exonic
1074768386 10:116717213-116717235 GAGCTCTGAGTCTGCCTGGGTGG - Intronic
1078348220 11:10570510-10570532 GAGCTCTGCTTGAGCCCAGGAGG - Intronic
1082774731 11:57236410-57236432 GAGCTCAGAGTGGGCCTGGGAGG - Exonic
1090269292 11:125374670-125374692 GAGCTCTACCTAGGTCAGGGAGG - Intronic
1093740029 12:22675156-22675178 GAGGACTGCTTAAGCCCGGGAGG - Intronic
1101606089 12:106248235-106248257 GGGGTCTGCGGAGGCCGGGGTGG + Intronic
1105910480 13:24860965-24860987 GAGGACTGCCTAAGCCCGGGAGG - Intronic
1117130340 14:52679968-52679990 GAGGACTGCTTAGGCCCAGGAGG + Intronic
1122885840 14:104709928-104709950 CTGCTCTGCGCAGGCCCGGGAGG + Intronic
1123500633 15:20878122-20878144 GAGCTCTGCGTGCGCCCGGCGGG + Intergenic
1123557878 15:21451815-21451837 GAGCTCTGCGTGCGCCCGGCGGG + Intergenic
1123594107 15:21889096-21889118 GAGCTCTGGGTGCGCCCGGCGGG + Intergenic
1124900894 15:33821447-33821469 GAGCCCTGCTAAGGCCCAGGAGG + Intronic
1125887754 15:43241250-43241272 GAGCTCTGCTTACGCCAGGAGGG + Intronic
1126802428 15:52310967-52310989 GAGCTCTGGGTAGACCTGGGAGG + Exonic
1127741055 15:61906184-61906206 GAGTTCTGCTTAGGCCCAAGTGG - Intronic
1130996806 15:88908688-88908710 GAGCCCTGGGTAGGGCCAGGTGG - Intronic
1132335876 15:101048412-101048434 GAGCTCTGCAGAGGCCGGGCTGG - Intronic
1202966229 15_KI270727v1_random:178987-179009 GAGCTCTGCGTGCGCCCGGCGGG + Intergenic
1132581002 16:684567-684589 GGGCTCGCCGTAGGCCCGCGGGG - Intronic
1132675299 16:1118887-1118909 GAGCTCTGCCCAGGTCCTGGAGG + Intergenic
1134524370 16:14932810-14932832 GAGCCCTGCAGAGGCGCGGGAGG - Intronic
1134548530 16:15128131-15128153 GAGCCCTGCAGAGGCGCGGGAGG + Intronic
1134711959 16:16331297-16331319 GAGCCCTGCAGAGGCGCGGGAGG - Intergenic
1134719817 16:16374590-16374612 GAGCCCTGCAGAGGCGCGGGAGG - Intergenic
1134947609 16:18337295-18337317 GAGCCCTGCAGAGGCGCGGGAGG + Intergenic
1134954869 16:18377397-18377419 GAGCCCTGCAGAGGCGCGGGAGG + Intergenic
1136070259 16:27783157-27783179 GAGCACTGCGCATGCCTGGGAGG - Intergenic
1136592250 16:31224523-31224545 GCGCTCTGCGCAGCCCCGAGAGG + Exonic
1137509158 16:49082937-49082959 CAGCCCTGCTTAGGCCCTGGAGG + Intergenic
1138239948 16:55419347-55419369 GAGCTCTGCAAAGGCCAGTGTGG - Intronic
1142201269 16:88762199-88762221 GAGCTCTGGGTGGGCCGGGAGGG - Intronic
1144424405 17:15127812-15127834 GAGATTTGCGTGGACCCGGGAGG + Intergenic
1144658227 17:17051669-17051691 GAGCTCTGGGTAGGGCATGGGGG - Intronic
1147370990 17:39992859-39992881 GTGCTCTGCTGAGGCCCAGGTGG - Intronic
1148717041 17:49723290-49723312 GAGGGCTGGGCAGGCCCGGGAGG - Intronic
1148777393 17:50103260-50103282 GAGCTCTGGGTAGGGAGGGGTGG + Intronic
1148873258 17:50671164-50671186 GAGCATTGCGTAAGCCCAGGAGG + Intronic
1150745494 17:67813424-67813446 GACCTCTGCGAAGGCGCTGGGGG + Intergenic
1151550825 17:74821637-74821659 GAGCTCTGGGTAAGGCCGAGTGG + Intronic
1153048327 18:877156-877178 TAGCTCTGTGGAGGCCCTGGAGG + Intergenic
1157370524 18:47106881-47106903 GAGCTCTGCGTGGTGCCTGGTGG - Intergenic
1160855422 19:1215100-1215122 GAGCTCGGGGTGGGCCCGAGAGG - Intronic
1160994397 19:1875999-1876021 GAGTTCCTCGTAGGCCCGTGGGG - Intergenic
1161044159 19:2126035-2126057 GAGGACTGCTTAAGCCCGGGAGG + Intronic
1161072510 19:2269910-2269932 GAGCACTGCTAAGGCCGGGGGGG - Intronic
1163043459 19:14620678-14620700 GAGCATTGCTTAAGCCCGGGAGG - Intronic
1163629860 19:18412774-18412796 GAGGACTGCTTAAGCCCGGGAGG + Intergenic
1163782698 19:19258636-19258658 GAGCCCTGCGGCGGCCTGGGGGG - Exonic
1165206919 19:34197526-34197548 GAGCACTGCTTAAGCCTGGGAGG - Intronic
932404390 2:71503806-71503828 GAGCACTGAGAAGGCCAGGGAGG - Intronic
932572968 2:72947580-72947602 GAGCTCTCCGAAGGCCAGGCTGG - Intronic
936764683 2:115832398-115832420 GAGGTCTGCTTAAGCCTGGGAGG + Intronic
937320869 2:120959967-120959989 GAGCTCTGTGCAGGCGCAGGGGG + Intronic
938257828 2:129873835-129873857 CAGCTCTGTGGAGGCCCTGGTGG - Intergenic
943094633 2:183414025-183414047 GTGCTCTGAGTAGGGCAGGGAGG + Intergenic
944597642 2:201276095-201276117 GAGGTCTGCGTAGCCCCTTGAGG - Intronic
947410361 2:229831539-229831561 GAGCACTGCTTGGGCCCAGGAGG + Intronic
948675525 2:239594509-239594531 GAGCTCAGAGGAGCCCCGGGAGG + Intergenic
1174082416 20:47979834-47979856 GTGCTCTGCGCAGGCCTGGCAGG - Intergenic
1178409127 21:32349352-32349374 GAGGTCGGCTTCGGCCCGGGCGG + Exonic
1179539218 21:42073391-42073413 GAGCTCTGCAAAGGAACGGGAGG - Intronic
1181170306 22:21004869-21004891 GAGGACTGCTTAAGCCCGGGAGG - Intergenic
1181612206 22:24023821-24023843 GAGAACTGCTTGGGCCCGGGAGG - Intronic
1182116679 22:27760682-27760704 GGGCTCTGCGTGGCCCCGGTGGG - Intronic
1183319346 22:37155706-37155728 CAGGTCTGGGTAGGCCCGAGTGG - Intronic
1183942084 22:41301733-41301755 GGGCTCGGCGCAGGCCCGCGGGG + Exonic
1184033153 22:41906416-41906438 AAGCTCAGGGTAGGCCCAGGGGG + Exonic
1185351825 22:50343503-50343525 CAGCTCTTCGGAGGCCCGTGTGG - Exonic
1185384531 22:50525791-50525813 GAGCTCTGCGAAGGGCGAGGGGG + Exonic
951217752 3:20040574-20040596 GAGCCCTGCGGGGGCGCGGGCGG - Exonic
954124857 3:48522192-48522214 CAGCTCTGGGGAGCCCCGGGAGG + Intronic
957299021 3:78367157-78367179 GAGCATTGCTTGGGCCCGGGAGG - Intergenic
965796789 3:172448484-172448506 GAGGTCCGCTTAGGCGCGGGAGG + Intergenic
968626891 4:1629819-1629841 GAGCTGTGGGTGGGCCGGGGTGG - Intronic
968643277 4:1725750-1725772 GAACTCTGCTGAGGCCCAGGTGG + Intronic
971376744 4:26061823-26061845 GAGCCCTGCTGAGGCCAGGGAGG + Intergenic
973774921 4:54233625-54233647 AGGCTCTGTGTGGGCCCGGGAGG + Intronic
975724513 4:77278947-77278969 GAGCTCCACGTGGGCCCGGATGG - Intronic
975853115 4:78593724-78593746 GAGGTCTGCTTGGGCCCAGGAGG - Intronic
982573212 4:157076163-157076185 GAGCTCGGCGGTGGCGCGGGCGG + Exonic
997926002 5:138032214-138032236 GCGCTCTGCATAGGCCAGGCTGG - Intronic
998225451 5:140323117-140323139 GCGCTCTGCCAAGGCCAGGGCGG + Intergenic
1001592274 5:172873613-172873635 GAGCTTTGGGGAGGCCAGGGAGG + Intronic
1002211153 5:177600134-177600156 AGGCGCCGCGTAGGCCCGGGAGG + Exonic
1002401534 5:178994060-178994082 GAGCGCTCCGCAGGCCCAGGGGG + Intronic
1006379212 6:33687967-33687989 GAGCTAGGCGAAGGCCTGGGAGG + Intronic
1006894518 6:37458657-37458679 GATGTCTGCGCAGGCCCAGGTGG + Exonic
1007623587 6:43229514-43229536 GGGCTCTGCGCTGGGCCGGGCGG - Intergenic
1011314522 6:86016783-86016805 GAGCTCTGCACAGACCAGGGAGG + Intergenic
1019621814 7:1996195-1996217 GAGCCGTGTGTAGACCCGGGGGG - Intronic
1019621829 7:1996233-1996255 GAGCCGTGTGTAGACCCGGGGGG - Intronic
1025074818 7:55933792-55933814 GAGAACTGCTTGGGCCCGGGAGG - Intronic
1026742932 7:72990318-72990340 GGGCTCCCAGTAGGCCCGGGTGG - Intergenic
1027100803 7:75374760-75374782 GGGCTCCCAGTAGGCCCGGGTGG + Intergenic
1034401295 7:150863383-150863405 GAGCTCTGAGCAGGGCTGGGAGG - Intergenic
1039914014 8:41846418-41846440 GAGCTCTGCCAAGGCCCGTGTGG + Intronic
1039981532 8:42412932-42412954 GGACTGTGGGTAGGCCCGGGAGG - Intergenic
1040386546 8:46918262-46918284 GGGCTCTGCGCTGGCCTGGGTGG - Intergenic
1048867534 8:138771839-138771861 GAGCTCTCCGCAGGCCCCGGGGG - Intronic
1048964385 8:139604758-139604780 GAGCCCTGGGTAGGCCCTGGGGG + Intronic
1049221754 8:141431722-141431744 GAGCCCTGCCTTGGCCAGGGTGG + Exonic
1060552818 9:124493661-124493683 GAGCTCTGCGTAGGCCCGGGGGG - Intronic
1060967172 9:127717783-127717805 GTGCCCTGCATGGGCCCGGGAGG - Intronic
1061613583 9:131764479-131764501 GAGGAATGCTTAGGCCCGGGAGG - Intergenic
1061801077 9:133113719-133113741 GACCCCTGAGGAGGCCCGGGTGG - Intronic
1062280062 9:135747806-135747828 GAGCCCTGAGTATGCCCGGTGGG + Intronic
1200206177 X:154317889-154317911 GAGCTCTGTGTGGGCCTGGGGGG + Intronic
1202372158 Y:24205840-24205862 GAGCTGTGTGGAGGCCTGGGCGG + Intergenic
1202498627 Y:25464276-25464298 GAGCTGTGTGGAGGCCTGGGCGG - Intergenic