ID: 1060552819

View in Genome Browser
Species Human (GRCh38)
Location 9:124493662-124493684
Sequence AGAGCTCTGCGTAGGCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 79}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060552819_1060552826 -10 Left 1060552819 9:124493662-124493684 CCCCCGGGCCTACGCAGAGCTCT 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1060552826 9:124493675-124493697 GCAGAGCTCTCAGGCTCAGGAGG No data
1060552819_1060552831 10 Left 1060552819 9:124493662-124493684 CCCCCGGGCCTACGCAGAGCTCT 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1060552831 9:124493695-124493717 AGGAGGAGGGAGGTCCCACCTGG No data
1060552819_1060552833 22 Left 1060552819 9:124493662-124493684 CCCCCGGGCCTACGCAGAGCTCT 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1060552833 9:124493707-124493729 GTCCCACCTGGCCTGAGGTCAGG No data
1060552819_1060552829 -3 Left 1060552819 9:124493662-124493684 CCCCCGGGCCTACGCAGAGCTCT 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1060552829 9:124493682-124493704 TCTCAGGCTCAGGAGGAGGAGGG No data
1060552819_1060552837 28 Left 1060552819 9:124493662-124493684 CCCCCGGGCCTACGCAGAGCTCT 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1060552837 9:124493713-124493735 CCTGGCCTGAGGTCAGGCCCAGG No data
1060552819_1060552832 17 Left 1060552819 9:124493662-124493684 CCCCCGGGCCTACGCAGAGCTCT 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1060552832 9:124493702-124493724 GGGAGGTCCCACCTGGCCTGAGG No data
1060552819_1060552827 -7 Left 1060552819 9:124493662-124493684 CCCCCGGGCCTACGCAGAGCTCT 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1060552827 9:124493678-124493700 GAGCTCTCAGGCTCAGGAGGAGG No data
1060552819_1060552830 0 Left 1060552819 9:124493662-124493684 CCCCCGGGCCTACGCAGAGCTCT 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1060552830 9:124493685-124493707 CAGGCTCAGGAGGAGGAGGGAGG No data
1060552819_1060552838 29 Left 1060552819 9:124493662-124493684 CCCCCGGGCCTACGCAGAGCTCT 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1060552838 9:124493714-124493736 CTGGCCTGAGGTCAGGCCCAGGG No data
1060552819_1060552828 -4 Left 1060552819 9:124493662-124493684 CCCCCGGGCCTACGCAGAGCTCT 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1060552828 9:124493681-124493703 CTCTCAGGCTCAGGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060552819 Original CRISPR AGAGCTCTGCGTAGGCCCGG GGG (reversed) Intronic
902089680 1:13893216-13893238 AGAGCGCTGCCCAGGCCCCGCGG - Intergenic
902219789 1:14957706-14957728 ACAGCTCTGCGGAGGCCCTGAGG + Intronic
903860108 1:26360022-26360044 CGAGCGGTGCGGAGGCCCGGGGG - Intergenic
905721326 1:40205158-40205180 AGAGCTCTTCTTAGGTCCAGAGG + Intronic
912167425 1:107057267-107057289 AGAGCTCGGCGGAGGCCGGCAGG - Exonic
1064582716 10:16810472-16810494 AGAGCTGTGCATAGCCCGGGGGG - Intronic
1065069105 10:22003676-22003698 ACAGCTGTGTGTAGGCCTGGGGG - Exonic
1074456638 10:113601256-113601278 AAAGCTCTGGGTAGGGCCAGAGG - Intronic
1077190846 11:1255482-1255504 AGAGCTCTGCGTAAGCCTCCAGG - Exonic
1078477051 11:11639904-11639926 AGACTTCTGAGTAGGCCCAGTGG - Intergenic
1078652822 11:13211862-13211884 AGTGCTCTGCAAAGGCCCTGTGG + Intergenic
1092171099 12:6374609-6374631 AGAGCTCTCGGTAGGAGCGGTGG + Exonic
1101568552 12:105932507-105932529 ACAGCTCTGAGTAGGCGGGGTGG + Intergenic
1104400417 12:128471485-128471507 AGAGCTATGCCTAGGGCCAGGGG - Intronic
1123500632 15:20878121-20878143 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1123557877 15:21451814-21451836 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1123594106 15:21889095-21889117 TGAGCTCTGGGTGCGCCCGGCGG + Intergenic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1126689291 15:51275372-51275394 AAAGCTCTGAGTAGGGCTGGAGG - Intronic
1128672978 15:69588070-69588092 AGAGCTCAGCTGAGGCCCAGAGG - Intergenic
1128688369 15:69704348-69704370 AGAGCTCTGCCAAGGCCAAGAGG - Intergenic
1202966228 15_KI270727v1_random:178986-179008 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1132745469 16:1434478-1434500 AGGGCCCTGCGGAGGCCAGGAGG - Exonic
1136298805 16:29319632-29319654 AGAGCTCTCCGTAGCGCAGGTGG + Intergenic
1141819475 16:86434999-86435021 AAAGCTCTGCATAGTCCAGGTGG - Intergenic
1142060474 16:88026130-88026152 AGAGCTCTCCGTAGCGCAGGTGG + Intronic
1142201270 16:88762200-88762222 TGAGCTCTGGGTGGGCCGGGAGG - Intronic
1142534135 17:602045-602067 AAAGCACTGTGAAGGCCCGGAGG - Intronic
1144658228 17:17051670-17051692 AGAGCTCTGGGTAGGGCATGGGG - Intronic
1144849278 17:18235846-18235868 AGAGCCCAGCGTGGGCCTGGCGG + Intronic
1147808705 17:43151055-43151077 AGACCTCTGCAAAGGCCCTGAGG - Intergenic
1150336472 17:64334221-64334243 AGAGCTGGGCGCTGGCCCGGGGG - Intronic
1151863060 17:76780458-76780480 TGAGCTCTTCCTAGGCACGGTGG - Intronic
1152017549 17:77761535-77761557 AGAGCCCTGCATGGGCCTGGGGG + Intergenic
1161072511 19:2269911-2269933 AGAGCACTGCTAAGGCCGGGGGG - Intronic
1164485822 19:28654966-28654988 AGAGCACTGCATGGGCTCGGGGG - Intergenic
925367553 2:3321111-3321133 AGAGCTCTCCCTGGGCCGGGAGG - Intronic
928607920 2:32961249-32961271 AGAGCTCGGCAGAGACCCGGAGG - Intronic
933285315 2:80378905-80378927 AGAGTTCTGTGTAGGCTCTGGGG + Intronic
937103863 2:119292412-119292434 AGGGCTCTGCGTATGCCCGGAGG - Intergenic
937333699 2:121047565-121047587 GGAGCTCTGCCCAGGACCGGGGG + Intergenic
939189707 2:138902033-138902055 AGAGCTGTGCCCAGGCCCTGCGG - Intergenic
943188578 2:184646770-184646792 AGAGGTTTGCCTAGGCACGGAGG - Intronic
1173383657 20:42568682-42568704 ACAGCTCTCTGTAGGCCAGGAGG - Intronic
1175937940 20:62523532-62523554 AGGGCTCTGGGGAGGGCCGGGGG - Intergenic
1181539721 22:23566719-23566741 TGAGCTCTGCCAAGGGCCGGGGG + Intergenic
1182116680 22:27760683-27760705 CGGGCTCTGCGTGGCCCCGGTGG - Intronic
1183762280 22:39832753-39832775 AGAGCTCTGTGTCTCCCCGGGGG - Intronic
956030312 3:65030198-65030220 AGAGCTGTGCAAAGGCCCTGTGG + Intergenic
956647087 3:71466766-71466788 AGAGCACTGCCTAGGGCAGGGGG + Intronic
956779163 3:72590870-72590892 AGAGCACAGCGGAGGCCCCGGGG + Intergenic
959930770 3:111979373-111979395 AGAGCTCTGCCGCGGCCCTGCGG + Intronic
960105273 3:113788857-113788879 AGACCTCTGGGAAGTCCCGGAGG - Exonic
960969655 3:123130437-123130459 AGAGCTCAGAGCAGGCCCTGGGG - Intronic
960976455 3:123179516-123179538 TGAGCTCTGCGGAGGCCAGTAGG + Intronic
961043835 3:123695254-123695276 AGAGGTCCGCCTAGGCCTGGGGG - Intronic
965551341 3:169967376-169967398 AGATCCCTGCCTAGGCCCCGAGG - Intronic
968434055 4:576026-576048 AGAGCGCGGCGCAGGCCCCGCGG + Intergenic
969603988 4:8193141-8193163 CGTGCTCTGGGTAGGGCCGGGGG - Intronic
990282588 5:54267376-54267398 AGAGCTCTGGCCAGGCGCGGTGG - Intronic
992259640 5:74956902-74956924 AGAGCTCTGGCTGGGCCCGGTGG + Intergenic
996234422 5:121108607-121108629 AGAGCTGAGCAGAGGCCCGGCGG - Intergenic
997566959 5:134895391-134895413 AGAGCACTGAGTATGCCTGGGGG - Intronic
998797480 5:145835309-145835331 AGGGCTCCGCAGAGGCCCGGAGG + Intronic
1001565983 5:172699795-172699817 AGAGCACAGCGAAGGCCCAGGGG + Intergenic
1002564011 5:180100002-180100024 AGGGCTCTGCCCAGGCCCTGCGG + Intergenic
1002619058 5:180474029-180474051 AGAGCTCTGGCTGGGCACGGTGG + Intergenic
1005124413 6:22429980-22430002 AGAGCTCTGCGTGGGCTCACGGG - Intergenic
1008211037 6:48726417-48726439 AGAGCTCTGTCTAGGCTCAGAGG + Intergenic
1019316684 7:390245-390267 ACAGCCCTGCGTGTGCCCGGAGG - Intergenic
1029731612 7:102442121-102442143 AAACCTCTGCATAGGCCAGGCGG + Intronic
1038041432 8:23727088-23727110 GGAGCTCCGCGCAGGCCGGGGGG + Intergenic
1040516918 8:48143214-48143236 AAAGCCCTTCTTAGGCCCGGCGG + Intergenic
1048867535 8:138771840-138771862 AGAGCTCTCCGCAGGCCCCGGGG - Intronic
1048964384 8:139604757-139604779 TGAGCCCTGGGTAGGCCCTGGGG + Intronic
1049409454 8:142465973-142465995 AGAGCCCTGTGGAGGCCCCGTGG + Intronic
1049610430 8:143552653-143552675 AGAGCCCTGCTAAGGCCAGGGGG - Intergenic
1049789737 8:144467077-144467099 AGAGAGCTGCGGGGGCCCGGCGG + Exonic
1053163396 9:35828958-35828980 AGATCTGTGCGTACGTCCGGGGG + Intronic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060758556 9:126229788-126229810 AGAGCTGTGCAAAGGCCCTGAGG + Intergenic
1060795628 9:126510801-126510823 AGAGGTCTGGGAAGGCCCTGAGG + Intergenic
1061275881 9:129569183-129569205 TGAGCTCTGCCAAGGGCCGGGGG + Intergenic
1061994075 9:134175292-134175314 ACAGCTCTGCAAAGGCCCTGAGG + Intergenic
1062280061 9:135747805-135747827 GGAGCCCTGAGTATGCCCGGTGG + Intronic
1186496576 X:10015979-10016001 CGAGCTCTGCCCGGGCCCGGGGG - Intronic
1200206176 X:154317888-154317910 GGAGCTCTGTGTGGGCCTGGGGG + Intronic