ID: 1060552820

View in Genome Browser
Species Human (GRCh38)
Location 9:124493663-124493685
Sequence GAGAGCTCTGCGTAGGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 75}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060552820_1060552831 9 Left 1060552820 9:124493663-124493685 CCCCGGGCCTACGCAGAGCTCTC 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1060552831 9:124493695-124493717 AGGAGGAGGGAGGTCCCACCTGG No data
1060552820_1060552837 27 Left 1060552820 9:124493663-124493685 CCCCGGGCCTACGCAGAGCTCTC 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1060552837 9:124493713-124493735 CCTGGCCTGAGGTCAGGCCCAGG No data
1060552820_1060552838 28 Left 1060552820 9:124493663-124493685 CCCCGGGCCTACGCAGAGCTCTC 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1060552838 9:124493714-124493736 CTGGCCTGAGGTCAGGCCCAGGG No data
1060552820_1060552832 16 Left 1060552820 9:124493663-124493685 CCCCGGGCCTACGCAGAGCTCTC 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1060552832 9:124493702-124493724 GGGAGGTCCCACCTGGCCTGAGG No data
1060552820_1060552829 -4 Left 1060552820 9:124493663-124493685 CCCCGGGCCTACGCAGAGCTCTC 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1060552829 9:124493682-124493704 TCTCAGGCTCAGGAGGAGGAGGG No data
1060552820_1060552828 -5 Left 1060552820 9:124493663-124493685 CCCCGGGCCTACGCAGAGCTCTC 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1060552828 9:124493681-124493703 CTCTCAGGCTCAGGAGGAGGAGG No data
1060552820_1060552827 -8 Left 1060552820 9:124493663-124493685 CCCCGGGCCTACGCAGAGCTCTC 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1060552827 9:124493678-124493700 GAGCTCTCAGGCTCAGGAGGAGG No data
1060552820_1060552833 21 Left 1060552820 9:124493663-124493685 CCCCGGGCCTACGCAGAGCTCTC 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1060552833 9:124493707-124493729 GTCCCACCTGGCCTGAGGTCAGG No data
1060552820_1060552830 -1 Left 1060552820 9:124493663-124493685 CCCCGGGCCTACGCAGAGCTCTC 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1060552830 9:124493685-124493707 CAGGCTCAGGAGGAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060552820 Original CRISPR GAGAGCTCTGCGTAGGCCCG GGG (reversed) Intronic
900106382 1:982992-983014 CAGAGCACGGCGTGGGCCCGAGG - Intergenic
901807943 1:11749652-11749674 GAGAGGAGTGCGTGGGCCCGGGG + Intronic
906796356 1:48699161-48699183 GGGAGCTCTGCATAGGACCCAGG + Intronic
907988493 1:59556077-59556099 GAGAGATCTGCAGAGGCCTGAGG + Intronic
909407281 1:75305619-75305641 GAGAGCTCTGAGTGTGCCCAAGG - Intronic
912576049 1:110674106-110674128 GAGAGCTCCGGGCCGGCCCGGGG - Exonic
916428724 1:164707306-164707328 GAGAGCACTGAGTAAGCCAGGGG + Intronic
917981420 1:180271955-180271977 GAGAGCTCTGCAGAGGACTGTGG + Exonic
921993806 1:221395912-221395934 GAGAGCTCTGAAGAGGCCCCGGG + Intergenic
922603595 1:226875013-226875035 GAGAACTCTGCCTGGGCCCCAGG + Intronic
1067068911 10:43118713-43118735 GAGACCTCTGAGTAGCCCTGTGG - Intronic
1076741197 10:132486584-132486606 GAGAGCTCTGTGTGGACTCGGGG - Intergenic
1078569441 11:12444791-12444813 GAGACCTCAGCGTTGGCCCTAGG + Intronic
1083970130 11:66069840-66069862 GAGAGGTCGGCGGAGACCCGGGG - Intergenic
1091974023 12:4810543-4810565 GAGAGCTCTGGGCCGGCCAGGGG + Exonic
1102438176 12:112941577-112941599 GAGAGCTGTGCCCCGGCCCGAGG - Exonic
1102910375 12:116709021-116709043 GAGAGCTCCACGCAGGCACGGGG + Intergenic
1108433862 13:50382368-50382390 GAGAGCTCTGACCAGGCCCATGG + Intronic
1111866470 13:93774914-93774936 GAGAGCTCAGCCAAGGCCCCTGG + Intronic
1113993177 14:16045126-16045148 GATACCTCTGCATTGGCCCGAGG + Intergenic
1114655202 14:24311589-24311611 GAAGGCTCTGGGGAGGCCCGAGG + Exonic
1122331036 14:100913298-100913320 GAGAGCTATGCTTGGGCCAGTGG + Intergenic
1123205736 14:106711373-106711395 GAGAGCACTGCAGAGCCCCGTGG - Intergenic
1129167019 15:73784473-73784495 GAGAGCTCTCATCAGGCCCGAGG - Intergenic
1131866855 15:96720498-96720520 AAGAGCTCTGCGTCGGCTTGTGG + Intergenic
1132581004 16:684569-684591 GCGGGCTCGCCGTAGGCCCGCGG - Intronic
1133258926 16:4536046-4536068 GAGAGCTCTGCAGAGGACCTTGG - Intronic
1135113377 16:19707721-19707743 GAGTGCTCTGTGTAGGGTCGTGG - Intronic
1137531407 16:49281098-49281120 AAGGGCTCTGCGGAGGCGCGGGG - Intronic
1142356765 16:89605041-89605063 GAAGGCTCTGCGGAGGCCCCAGG + Intergenic
1144658229 17:17051671-17051693 GAGAGCTCTGGGTAGGGCATGGG - Intronic
1147377040 17:40028696-40028718 GGATGCTCTGCCTAGGCCCGTGG + Intronic
1150336473 17:64334222-64334244 GAGAGCTGGGCGCTGGCCCGGGG - Intronic
1157310906 18:46552569-46552591 GAGAGCTCTGTGTGGTCCAGGGG - Intronic
1160247802 18:77173514-77173536 GTGACAGCTGCGTAGGCCCGGGG + Intergenic
1161072512 19:2269912-2269934 GAGAGCACTGCTAAGGCCGGGGG - Intronic
1165406389 19:35633706-35633728 GAGAGCTGGGCCTAGGCCTGGGG + Exonic
1165934978 19:39383717-39383739 GGGATCTCTGCTGAGGCCCGGGG + Exonic
929780167 2:44952280-44952302 GAGAGCGCCGCGAAGGCCGGAGG - Intergenic
933285314 2:80378904-80378926 GAGAGTTCTGTGTAGGCTCTGGG + Intronic
946178250 2:217935060-217935082 GAGAGGTCTGTGTAGTGCCGCGG - Intronic
948592428 2:239059927-239059949 GAGAGCTCTCCGGGGGCCCTTGG + Intronic
948757683 2:240168857-240168879 GAGAGCCCTGCTTGGGCCCCTGG - Intergenic
1169426172 20:5498931-5498953 GAGAGTTCTTCTTAGGCCCTGGG + Intergenic
1169619780 20:7492358-7492380 GAGAACTCTGCAGAGGCCCAAGG + Intergenic
1171811846 20:29750725-29750747 GATACCTCTGCATTGGCCCGAGG - Intergenic
1172134978 20:32680820-32680842 GAGAGCTCTGCAAAGGCCCCAGG + Intergenic
1175937941 20:62523533-62523555 GAGGGCTCTGGGGAGGGCCGGGG - Intergenic
1176553042 21:8238388-8238410 GATACCTCTGCATTGGCCCGAGG + Intergenic
1176571964 21:8421412-8421434 GATACCTCTGCATTGGCCCGAGG + Intergenic
1176579873 21:8465995-8466017 GATACCTCTGCATTGGCCCGAGG + Intergenic
1180314091 22:11262387-11262409 GATACCTCTGCATTGGCCCGAGG - Intergenic
1181167963 22:20993379-20993401 CAGAGCTCTGCTGAGGCCTGGGG + Intronic
1203258040 22_KI270733v1_random:155430-155452 GATACCTCTGCATTGGCCCGAGG + Intergenic
960094693 3:113677925-113677947 GAGAGGTCTGGGTAGGGCCCAGG + Intronic
968627914 4:1636374-1636396 GAGACCTCTGCCTAGGACGGGGG + Intronic
968701456 4:2059920-2059942 GGGAGCTCCGCGCCGGCCCGAGG - Intronic
971480922 4:27114423-27114445 GAGAGCTGTACGCAGGCCCTGGG - Intergenic
975139203 4:70902691-70902713 GAGCGCTCCGCGCAGTCCCGGGG - Intronic
991054384 5:62306133-62306155 GCGCGCTCTGCGCAGGCGCGCGG + Intergenic
1003425438 6:5995530-5995552 CAGAGCCCTGCCTGGGCCCGAGG - Intergenic
1005124414 6:22429981-22430003 CAGAGCTCTGCGTGGGCTCACGG - Intergenic
1005582462 6:27247926-27247948 GAGAGCTCTGCCCAGGGCCTGGG + Exonic
1006459889 6:34152221-34152243 GAGAGCTGGACGTAGGCCCCGGG + Intronic
1019472881 7:1230442-1230464 GAGAGCTCTTCAGAGGCCCTCGG - Intergenic
1019914394 7:4123463-4123485 GGGAGCTCTGTGCAGGCCCAGGG + Intronic
1039467933 8:37797169-37797191 GAGTGCTCAGCGGGGGCCCGGGG - Intronic
1047729051 8:127711020-127711042 GTGAGCACTACGTAGGCCCTGGG - Intergenic
1048867536 8:138771841-138771863 AAGAGCTCTCCGCAGGCCCCGGG - Intronic
1053163395 9:35828957-35828979 GAGATCTGTGCGTACGTCCGGGG + Intronic
1057828377 9:98388521-98388543 CAAAGCTCTGAGAAGGCCCGTGG + Intronic
1058711311 9:107681826-107681848 GAGAGCTCAGCGTTGGTCCCTGG + Intergenic
1059524567 9:114978656-114978678 GAGAGCTCTGCAGAGCCCCAAGG - Intergenic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1203474234 Un_GL000220v1:137453-137475 GATACCTCTGCATTGGCCCGAGG + Intergenic
1203362403 Un_KI270442v1:228506-228528 GATACCTCTGCATTGGCCCGAGG - Intergenic
1195078397 X:101348767-101348789 GAGTGCACTGCGTCGGCGCGAGG + Exonic