ID: 1060552821

View in Genome Browser
Species Human (GRCh38)
Location 9:124493664-124493686
Sequence TGAGAGCTCTGCGTAGGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 175}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060552821_1060552832 15 Left 1060552821 9:124493664-124493686 CCCGGGCCTACGCAGAGCTCTCA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 1060552832 9:124493702-124493724 GGGAGGTCCCACCTGGCCTGAGG No data
1060552821_1060552827 -9 Left 1060552821 9:124493664-124493686 CCCGGGCCTACGCAGAGCTCTCA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 1060552827 9:124493678-124493700 GAGCTCTCAGGCTCAGGAGGAGG No data
1060552821_1060552831 8 Left 1060552821 9:124493664-124493686 CCCGGGCCTACGCAGAGCTCTCA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 1060552831 9:124493695-124493717 AGGAGGAGGGAGGTCCCACCTGG No data
1060552821_1060552829 -5 Left 1060552821 9:124493664-124493686 CCCGGGCCTACGCAGAGCTCTCA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 1060552829 9:124493682-124493704 TCTCAGGCTCAGGAGGAGGAGGG No data
1060552821_1060552828 -6 Left 1060552821 9:124493664-124493686 CCCGGGCCTACGCAGAGCTCTCA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 1060552828 9:124493681-124493703 CTCTCAGGCTCAGGAGGAGGAGG No data
1060552821_1060552838 27 Left 1060552821 9:124493664-124493686 CCCGGGCCTACGCAGAGCTCTCA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 1060552838 9:124493714-124493736 CTGGCCTGAGGTCAGGCCCAGGG No data
1060552821_1060552837 26 Left 1060552821 9:124493664-124493686 CCCGGGCCTACGCAGAGCTCTCA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 1060552837 9:124493713-124493735 CCTGGCCTGAGGTCAGGCCCAGG No data
1060552821_1060552833 20 Left 1060552821 9:124493664-124493686 CCCGGGCCTACGCAGAGCTCTCA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 1060552833 9:124493707-124493729 GTCCCACCTGGCCTGAGGTCAGG No data
1060552821_1060552830 -2 Left 1060552821 9:124493664-124493686 CCCGGGCCTACGCAGAGCTCTCA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 1060552830 9:124493685-124493707 CAGGCTCAGGAGGAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060552821 Original CRISPR TGAGAGCTCTGCGTAGGCCC GGG (reversed) Intronic
904677944 1:32209844-32209866 TGAGAGCTAAGAGTAGGACCTGG - Intronic
906248654 1:44294624-44294646 AGAGAGCTCTGGCCAGGCCCTGG - Intronic
907600752 1:55766923-55766945 TGAGAGCTAGGCATAAGCCCAGG + Intergenic
910759949 1:90723961-90723983 TGAAAACCCTGCTTAGGCCCTGG + Intergenic
912418629 1:109528851-109528873 TGTGAGCTCTTTCTAGGCCCAGG - Intergenic
919858058 1:201719109-201719131 TGCGAACTCTGTGTAGACCCTGG + Intronic
919872590 1:201833876-201833898 TGGGAGGACTGCGTAAGCCCAGG - Intronic
920372775 1:205490066-205490088 TCAGAGCTCTGTGTCTGCCCCGG + Intergenic
921283514 1:213589097-213589119 TGAGGGCTCTGAGGAGGCCTGGG + Intergenic
921993805 1:221395911-221395933 AGAGAGCTCTGAAGAGGCCCCGG + Intergenic
922575932 1:226660655-226660677 TGTGAGCTCTGCGAGGCCCCTGG - Intronic
923233399 1:232009792-232009814 TCAGAGCTCTTTGTTGGCCCAGG + Intronic
1063441241 10:6075108-6075130 TGAGAGCTCTGCTCCGGCCGTGG + Intergenic
1065240521 10:23699220-23699242 TCACAGCTCTGCCTAGGACCAGG - Intronic
1067027077 10:42852502-42852524 TAAGAGCTCTGCCTAGTTCCTGG + Intergenic
1067555234 10:47264938-47264960 TGCCAGCTCTGCCTGGGCCCTGG + Intergenic
1068734690 10:60399529-60399551 AGAGAGCTCTCCGATGGCCCTGG - Intronic
1069015583 10:63425687-63425709 TGGGAGGACTGCTTAGGCCCAGG + Intronic
1069465527 10:68635364-68635386 TGAGAGGACTGCTTAAGCCCAGG + Intronic
1069639602 10:69946132-69946154 TGAGAGTTCTCCCTTGGCCCTGG - Intronic
1069749399 10:70735860-70735882 TGACAGCTCAGCCTGGGCCCTGG - Intronic
1070019212 10:72567249-72567271 TGAGAGCACTACTTAAGCCCAGG + Intronic
1070223822 10:74479222-74479244 GGTGAGCTCTGCTTAGTCCCGGG - Intronic
1076429523 10:130391787-130391809 TGAGGGCTCTGCATAGGTTCTGG + Intergenic
1076751007 10:132543034-132543056 TGAGAGCACTGCTTGAGCCCAGG - Intronic
1077232214 11:1462918-1462940 AGAGAGCTCCGCCCAGGCCCTGG - Intergenic
1078348221 11:10570513-10570535 AGAGAGCTCTGCTTGAGCCCAGG - Intronic
1078546889 11:12253278-12253300 TGGCAGCTCTGCCTGGGCCCTGG - Intronic
1081966403 11:47172792-47172814 TGGGAGCTCTGTGGAGGCTCTGG - Intronic
1088479394 11:110280733-110280755 TGAGAGGACTGCTTAAGCCCAGG + Intronic
1088847680 11:113681756-113681778 TGAGAGGACTGCTGAGGCCCAGG - Intergenic
1089256864 11:117198841-117198863 TGAGAGCACTGCAAAGGGCCTGG + Intergenic
1089263203 11:117237170-117237192 TGAGAGGACTGCTTAAGCCCAGG - Intronic
1090398926 11:126436062-126436084 TGAGAGCTCTGAGCAGACGCTGG + Intronic
1093467820 12:19468221-19468243 TGGGAGCACTGCTTAAGCCCAGG - Intronic
1095040549 12:37435807-37435829 TGAGAGCTCTGGGTGGGCCAGGG - Intergenic
1095094321 12:38137625-38137647 GGAGAGCTGTGCGCATGCCCTGG + Intergenic
1096873783 12:54611602-54611624 TGAGGGTTGTGCGTAGGGCCTGG + Intergenic
1097429993 12:59493709-59493731 TGAGAGGTCTGAGGAGACCCTGG + Intergenic
1098172981 12:67765264-67765286 TGGGAGCTCTGCGGAGTCTCAGG - Intergenic
1100076227 12:90787262-90787284 TGAGAACTCTGCTTAACCCCAGG - Intergenic
1103794646 12:123494870-123494892 TCAGAGCTCTGTGTGGTCCCTGG + Intronic
1104400419 12:128471487-128471509 TCAGAGCTATGCCTAGGGCCAGG - Intronic
1104810497 12:131617514-131617536 TGAGAGCTCCGAGTATGTCCTGG + Intergenic
1104848323 12:131858268-131858290 TGGGTGCTCTGGGGAGGCCCTGG + Intergenic
1104848339 12:131858322-131858344 TGAATGCTCTGGGGAGGCCCTGG + Intergenic
1106753173 13:32795741-32795763 TGAGAGCTGTGCATCGGTCCTGG - Intergenic
1106911680 13:34469851-34469873 TGAGATGTCTGGTTAGGCCCTGG + Intergenic
1109478466 13:62916105-62916127 TGAGAGCACAGCAAAGGCCCAGG + Intergenic
1113031949 13:106003194-106003216 TAAGAGGTCTGCATAGACCCAGG + Intergenic
1114525764 14:23366145-23366167 TGAGAGGGCTGCGAAGGCTCCGG + Intergenic
1115337394 14:32255333-32255355 TGTGAGCCCTGCTCAGGCCCAGG + Intergenic
1117130339 14:52679965-52679987 TGAGAGGACTGCTTAGGCCCAGG + Intronic
1118426703 14:65672550-65672572 TGAGAGGACTGCTTAAGCCCAGG - Intronic
1122113661 14:99517432-99517454 TGAGAGGTGTGGGTGGGCCCTGG - Intronic
1122357912 14:101135086-101135108 AGAGAGCCCTGGGTAAGCCCAGG + Intergenic
1123066814 14:105623163-105623185 GGAGAGCTGTGCGGAGGCGCAGG - Intergenic
1123070842 14:105641874-105641896 GGAGAGCTGTGCGGAGGCGCAGG - Intergenic
1123075800 14:105666931-105666953 GGAGAGCTGTGCGGAGGCGCAGG - Intergenic
1123090498 14:105740158-105740180 GGAGAGCTGTGCGGAGGCGCAGG - Intergenic
1123096134 14:105767908-105767930 GGAGAGCTGTGCGGAGGCGCAGG - Intergenic
1126931912 15:53662974-53662996 TGAGAGAACTGCTTGGGCCCAGG + Intronic
1127492021 15:59473902-59473924 TGAGAGGACTGCTTGGGCCCAGG - Intronic
1130996807 15:88908691-88908713 TCAGAGCCCTGGGTAGGGCCAGG - Intronic
1131504364 15:93003190-93003212 TGAGAGGATTGCTTAGGCCCAGG + Intronic
1132224032 15:100126833-100126855 TGAGAGCTCTGTGCAGGCCCGGG - Intronic
1132939248 16:2498830-2498852 TGGGAGCTCTGGGTTGGGCCTGG + Intronic
1133248379 16:4464127-4464149 TGAGAGAGCTGGGCAGGCCCAGG - Intronic
1133525889 16:6605144-6605166 TGAGAGTACTGCTTAAGCCCAGG + Intronic
1133708113 16:8375068-8375090 TCAGGGCTCTGAGAAGGCCCCGG + Intergenic
1137294963 16:47083310-47083332 TGAGTGCCCTGAGCAGGCCCTGG - Exonic
1138188515 16:54995665-54995687 TGAGTGCTTTGCACAGGCCCCGG - Intergenic
1140559810 16:75965916-75965938 AGAGGGCTCTGCATATGCCCAGG - Intergenic
1141240599 16:82261922-82261944 TGTGAGCTCTTCGAAGGCACAGG - Intergenic
1141438539 16:84014609-84014631 TGAGAGCTCTGGGCAGAGCCAGG + Intronic
1203119123 16_KI270728v1_random:1520971-1520993 TAAGGGCTCTGCCTAGTCCCTGG - Intergenic
1142590896 17:1005517-1005539 TGAAAGCTCTGAAGAGGCCCTGG - Exonic
1143498790 17:7327141-7327163 TGAGGGCTTTGGGGAGGCCCTGG - Intronic
1144459712 17:15448619-15448641 TGAGAGGCCTGCAAAGGCCCAGG - Intronic
1144658230 17:17051672-17051694 TGAGAGCTCTGGGTAGGGCATGG - Intronic
1145377286 17:22362549-22362571 TGAGAGCTCTGGGTGGGCCAGGG + Intergenic
1145934144 17:28705266-28705288 TGAGAGATCAGCGTGGGCCAGGG - Intronic
1147370991 17:39992862-39992884 AGAGTGCTCTGCTGAGGCCCAGG - Intronic
1148813745 17:50312095-50312117 TGGGAGATCTGCTTAAGCCCAGG + Intergenic
1150290729 17:63980098-63980120 TGTGAGCTCTGGGTGGGTCCTGG - Intergenic
1152858106 17:82677704-82677726 TGCGGGCTCTGTGTAGGGCCAGG - Intronic
1152981024 18:276580-276602 TGAGAGGACTGCTTGGGCCCAGG + Intergenic
1153690877 18:7592481-7592503 TGACAGCTCTGCTTAGGACCAGG - Intronic
1157370525 18:47106884-47106906 AGAGAGCTCTGCGTGGTGCCTGG - Intergenic
1164423081 19:28114510-28114532 TGAGAGCATTGCTTGGGCCCAGG + Intergenic
1164617829 19:29677273-29677295 TGAAGGCTCTGCGAAGGTCCTGG - Intergenic
1165575830 19:36816378-36816400 TGAGAGGACTGCTTGGGCCCAGG - Intergenic
1165599044 19:37037248-37037270 TGAGAGCTCTGGGTGGGCCGGGG + Intronic
1165744997 19:38225337-38225359 TGAGAGCACTGCTTGAGCCCAGG + Intronic
1166502817 19:43353986-43354008 TGAGAGCGGTGAGAAGGCCCTGG + Exonic
925024163 2:594818-594840 TGAGCGCTGTTCCTAGGCCCTGG - Intergenic
931899865 2:66776353-66776375 AGAGAGCTCAGCGAAGGGCCAGG - Intergenic
933274241 2:80266784-80266806 TGAGAGATCTGTGTGTGCCCAGG + Intronic
933285313 2:80378903-80378925 AGAGAGTTCTGTGTAGGCTCTGG + Intronic
937273472 2:120669916-120669938 TGAGATCTCTGCGCAGACCTGGG - Intergenic
937320866 2:120959964-120959986 TGTGAGCTCTGTGCAGGCGCAGG + Intronic
940097976 2:149999824-149999846 TGAGAGGACTGCCTGGGCCCAGG + Intergenic
944721499 2:202427265-202427287 TGAGAGGATTGCTTAGGCCCGGG + Intronic
946193689 2:218021163-218021185 TGAGAGCTCTGCACAGCCCTTGG + Intergenic
947410360 2:229831536-229831558 CGAGAGCACTGCTTGGGCCCAGG + Intronic
947846842 2:233251576-233251598 CGAGCGCCCTGCGTAGGCACCGG + Exonic
948071544 2:235131768-235131790 TGGGAGCTCGGCTTGGGCCCCGG + Intergenic
948460750 2:238128883-238128905 AGAGAGCTCCGCAGAGGCCCAGG + Exonic
1168802075 20:650130-650152 TGAGAGCAGTGGGTGGGCCCTGG + Intronic
1169426171 20:5498930-5498952 AGAGAGTTCTTCTTAGGCCCTGG + Intergenic
1171572772 20:26269478-26269500 TGAGAGCTCTGTGTGGGCCGGGG + Intergenic
1171805955 20:29680472-29680494 TGAGAGCTCTGGGTGGGCCAGGG + Intergenic
1171838105 20:30175962-30175984 TGAGAGCTCTGGGTGGACCGGGG - Intergenic
1177137656 21:17323520-17323542 TGAGAGGACTGCTTGGGCCCAGG + Intergenic
1179629668 21:42668702-42668724 TGAGCCCTGTGCGGAGGCCCGGG + Intronic
1180855142 22:19040829-19040851 AGAGAGCTCTGAGAAGGCCTGGG - Intronic
1183698050 22:39434283-39434305 TGAGGGCTCAGCCTGGGCCCTGG + Intronic
1183727536 22:39597876-39597898 TGAGAGCTCCCCTCAGGCCCAGG - Intronic
1184820950 22:46908973-46908995 GGAGAGATCTGCGCAGGCCGGGG - Intronic
1185202534 22:49517010-49517032 TGAGAGCTCTCGGTAAGGCCTGG - Intronic
950517657 3:13478217-13478239 TAAGTGGTCTGCGGAGGCCCTGG - Intergenic
950705417 3:14776945-14776967 TAAGAGCAGTGCGAAGGCCCAGG + Intergenic
952130411 3:30355282-30355304 TGAGAGCTGTGTGTAGGTCTTGG + Intergenic
954630646 3:52046070-52046092 TGAGAGCCCTGGGAAGGCTCGGG - Intergenic
954792329 3:53142561-53142583 TTTGAGCTCTGCGTAGGTCAAGG - Intergenic
959692412 3:109212128-109212150 TGAAATCTGTCCGTAGGCCCAGG + Intergenic
962895078 3:139706764-139706786 TGAGAGGTCTGCTGAGGTCCTGG + Intergenic
966896169 3:184446859-184446881 TGTGAGCTGTGAGTAGGCACAGG - Intronic
968686466 4:1962761-1962783 TGAGAGGATTGCTTAGGCCCAGG - Intronic
969363968 4:6683141-6683163 TGGGAGCTCTGCAAAGGCCAAGG - Intergenic
971480923 4:27114424-27114446 GGAGAGCTGTACGCAGGCCCTGG - Intergenic
972710372 4:41589291-41589313 AGAGAGCTGTGCAAAGGCCCTGG + Intronic
975853116 4:78593727-78593749 TGGGAGGTCTGCTTGGGCCCAGG - Intronic
983371728 4:166868365-166868387 TGGGAGGATTGCGTAGGCCCAGG + Intronic
984074718 4:175161419-175161441 AGAGAGCTATGTGTATGCCCAGG - Intergenic
985553797 5:546357-546379 TGGGAGCCCTGGGAAGGCCCGGG + Intergenic
985860460 5:2466606-2466628 TGACGGCTGTGCTTAGGCCCTGG - Intergenic
992378801 5:76216865-76216887 TGAGAGCTTTCATTAGGCCCAGG + Intronic
993022272 5:82605775-82605797 TGAGCACTCTGCCAAGGCCCTGG + Intergenic
998643156 5:144034912-144034934 TGAGAGCCTTGCTTAAGCCCAGG - Intergenic
999273074 5:150309335-150309357 TGAGAGGTCTGAGTGGGCCTAGG + Intronic
1002276984 5:178110337-178110359 TGAGAGCATTGCTTAAGCCCAGG - Intergenic
1004528247 6:16429158-16429180 TGAGGGCTGTGCGGTGGCCCTGG + Intronic
1005582461 6:27247925-27247947 GGAGAGCTCTGCCCAGGGCCTGG + Exonic
1006459888 6:34152220-34152242 AGAGAGCTGGACGTAGGCCCCGG + Intronic
1011037251 6:82991078-82991100 TGTGGGCTCTCCATAGGCCCTGG + Intronic
1011048031 6:83108403-83108425 TGGGAGGACTGCTTAGGCCCAGG - Intronic
1011099766 6:83708624-83708646 CGGGAGCTCTGCGGAGGCGCCGG + Intronic
1013362045 6:109402817-109402839 TGAGCGATTTCCGTAGGCCCTGG - Intronic
1013587353 6:111591393-111591415 TGAGAGGTCTGGGGAGGTCCTGG + Exonic
1013769531 6:113612331-113612353 TGAGAGAACTGCCTAAGCCCAGG - Intergenic
1014437480 6:121437061-121437083 TGAAAGCTTTGCGGAGGCCGTGG + Intronic
1014625307 6:123717717-123717739 TGAGAGTTCTTCATATGCCCTGG + Intergenic
1016938659 6:149467067-149467089 TGAGAGCTCTGCCAGGGTCCAGG - Intronic
1017819959 6:158042069-158042091 TGTGTGCCCTGCATAGGCCCAGG - Intronic
1018634294 6:165847244-165847266 TGAGAGCTCTGCCAAGCTCCCGG - Intronic
1018926963 6:168213242-168213264 TGAGAGCCCCTCGTGGGCCCTGG + Intergenic
1018926981 6:168213322-168213344 TGAGAGCCCCTCGTGGGCCCTGG + Intergenic
1019324126 7:429683-429705 CTAGAGCTCTGTGGAGGCCCAGG + Intergenic
1019914393 7:4123462-4123484 TGGGAGCTCTGTGCAGGCCCAGG + Intronic
1024889715 7:54185969-54185991 TGACATCTCTGCGTAGCCCTAGG + Intergenic
1024918945 7:54536436-54536458 ACAGAGCTCTGTGTAGTCCCTGG - Intergenic
1025206131 7:56994291-56994313 TGAGGGCTCTGTGCAGGCACAGG + Intergenic
1025286598 7:57667441-57667463 TGAGAGCTCTGGGTGGGCCAGGG - Intergenic
1025299468 7:57806586-57806608 TGAGAGCTCTGGGTGGGCCAGGG + Intergenic
1025665810 7:63582648-63582670 TGAGGGCTCTGTGCAGGCACAGG - Intergenic
1026037972 7:66843559-66843581 TGAGAGGACTGCTTATGCCCAGG + Intergenic
1027665202 7:81036122-81036144 TGAGAGCTATTCGTAGGAACAGG + Intergenic
1029606873 7:101604512-101604534 TGAGAGCCTTCCCTAGGCCCCGG - Intergenic
1030394336 7:108966779-108966801 TGACATCTCTGCTTGGGCCCAGG - Intergenic
1032677534 7:134145184-134145206 TGTGAGCTCTGTGTAGACCTGGG + Intronic
1034226580 7:149489584-149489606 AGAGGGCACTGCGAAGGCCCTGG + Intronic
1047729052 8:127711021-127711043 AGTGAGCACTACGTAGGCCCTGG - Intergenic
1047778755 8:128094860-128094882 TGAGAGGTCTGGGGAGGCTCTGG - Intergenic
1048867537 8:138771842-138771864 AAAGAGCTCTCCGCAGGCCCCGG - Intronic
1055527428 9:77149092-77149114 TGAGAGGACTGCTTAGGCCCAGG + Intergenic
1056545711 9:87611680-87611702 TGAGAGGGCTGCATAAGCCCAGG - Intronic
1057298196 9:93861361-93861383 TGAGAGCCCTGCAGAGCCCCAGG - Intergenic
1058890081 9:109354114-109354136 TGAGAGGACTGCCTAAGCCCAGG - Intergenic
1060552821 9:124493664-124493686 TGAGAGCTCTGCGTAGGCCCGGG - Intronic
1062376475 9:136264042-136264064 TGCCAGCCCTGCGTGGGCCCTGG - Intergenic
1185612099 X:1398903-1398925 TGTGAGCCCTACGGAGGCCCTGG + Intergenic
1186935998 X:14450436-14450458 AGGGGGCTCTGCCTAGGCCCAGG + Intergenic
1192563053 X:72140083-72140105 TGAGAGCCCTGAGTATGCCGAGG + Exonic
1200001529 X:153064022-153064044 TGAGAGCACTCAGTAGTCCCTGG - Intergenic
1200054756 X:153454460-153454482 TGACACCTCTGCGAAGGCCGTGG - Exonic
1200145263 X:153923086-153923108 TGGGAGCTCTGCCCAGACCCCGG - Intronic
1201766900 Y:17580572-17580594 TGAGAGCGGTGCGCATGCCCTGG - Intergenic
1201834653 Y:18325413-18325435 TGAGAGCGGTGCGCATGCCCTGG + Intergenic