ID: 1060552822

View in Genome Browser
Species Human (GRCh38)
Location 9:124493665-124493687
Sequence CTGAGAGCTCTGCGTAGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 161}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060552822_1060552830 -3 Left 1060552822 9:124493665-124493687 CCGGGCCTACGCAGAGCTCTCAG 0: 1
1: 0
2: 1
3: 21
4: 161
Right 1060552830 9:124493685-124493707 CAGGCTCAGGAGGAGGAGGGAGG No data
1060552822_1060552837 25 Left 1060552822 9:124493665-124493687 CCGGGCCTACGCAGAGCTCTCAG 0: 1
1: 0
2: 1
3: 21
4: 161
Right 1060552837 9:124493713-124493735 CCTGGCCTGAGGTCAGGCCCAGG No data
1060552822_1060552833 19 Left 1060552822 9:124493665-124493687 CCGGGCCTACGCAGAGCTCTCAG 0: 1
1: 0
2: 1
3: 21
4: 161
Right 1060552833 9:124493707-124493729 GTCCCACCTGGCCTGAGGTCAGG No data
1060552822_1060552828 -7 Left 1060552822 9:124493665-124493687 CCGGGCCTACGCAGAGCTCTCAG 0: 1
1: 0
2: 1
3: 21
4: 161
Right 1060552828 9:124493681-124493703 CTCTCAGGCTCAGGAGGAGGAGG No data
1060552822_1060552831 7 Left 1060552822 9:124493665-124493687 CCGGGCCTACGCAGAGCTCTCAG 0: 1
1: 0
2: 1
3: 21
4: 161
Right 1060552831 9:124493695-124493717 AGGAGGAGGGAGGTCCCACCTGG No data
1060552822_1060552827 -10 Left 1060552822 9:124493665-124493687 CCGGGCCTACGCAGAGCTCTCAG 0: 1
1: 0
2: 1
3: 21
4: 161
Right 1060552827 9:124493678-124493700 GAGCTCTCAGGCTCAGGAGGAGG No data
1060552822_1060552838 26 Left 1060552822 9:124493665-124493687 CCGGGCCTACGCAGAGCTCTCAG 0: 1
1: 0
2: 1
3: 21
4: 161
Right 1060552838 9:124493714-124493736 CTGGCCTGAGGTCAGGCCCAGGG No data
1060552822_1060552832 14 Left 1060552822 9:124493665-124493687 CCGGGCCTACGCAGAGCTCTCAG 0: 1
1: 0
2: 1
3: 21
4: 161
Right 1060552832 9:124493702-124493724 GGGAGGTCCCACCTGGCCTGAGG No data
1060552822_1060552829 -6 Left 1060552822 9:124493665-124493687 CCGGGCCTACGCAGAGCTCTCAG 0: 1
1: 0
2: 1
3: 21
4: 161
Right 1060552829 9:124493682-124493704 TCTCAGGCTCAGGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060552822 Original CRISPR CTGAGAGCTCTGCGTAGGCC CGG (reversed) Intronic
900217877 1:1491238-1491260 CAGAGAGCTCTGATCAGGCCGGG + Intronic
901234931 1:7662722-7662744 CAGAGAGCTGAGGGTAGGCCTGG + Intronic
913960199 1:143333597-143333619 CTCAGAGCTCAGCGTGGGCGAGG + Intergenic
914054555 1:144159170-144159192 CTCAGAGCTCAGCGTGGGCGAGG + Intergenic
914124591 1:144807191-144807213 CTCAGAGCTCAGCGTGGGCGAGG - Intergenic
915083333 1:153367032-153367054 CTGAGGGCTCTGTGAAGGCAGGG - Intergenic
918448299 1:184635544-184635566 CTGAGAGCTGTGGGAAGCCCTGG - Intergenic
920445737 1:206014837-206014859 CTCACAGCTCTTCCTAGGCCTGG + Intronic
921283513 1:213589096-213589118 CTGAGGGCTCTGAGGAGGCCTGG + Intergenic
922764019 1:228148420-228148442 CCTTCAGCTCTGCGTAGGCCTGG - Intronic
923950281 1:238943930-238943952 CTGACAGCCCTGTGTAGACCTGG + Intergenic
1065637355 10:27745225-27745247 CTGCGATCTCTGCGTGGGCTTGG - Intronic
1066162262 10:32746540-32746562 CTGACAGCTCTGCTTTGTCCAGG - Intronic
1066714590 10:38273024-38273046 CTGAGAGCTCTGGGATGGCAGGG + Intergenic
1067028632 10:42865850-42865872 CTCAGAGCTCAGCGTGGGCGAGG + Intergenic
1067164677 10:43855887-43855909 CTCGGAGCTCTGCCCAGGCCAGG - Intergenic
1069704001 10:70445907-70445929 CTTAGAGCCCTGTGGAGGCCTGG + Intronic
1072981882 10:100105315-100105337 CAGACAGCTCTGTGTAGACCAGG + Intergenic
1073046617 10:100642900-100642922 CTGGGAGGTCTGCGGAGGGCTGG - Intergenic
1074768388 10:116717217-116717239 CAGAGAGCTCTGAGTCTGCCTGG - Intronic
1075440279 10:122474621-122474643 CTGAGAAATCTGCGAAGGTCAGG + Intronic
1077490334 11:2858127-2858149 CAGAGAGCCCTGCCAAGGCCTGG + Intergenic
1077613739 11:3660608-3660630 CAGAGACCGCTGCGTTGGCCAGG - Intronic
1079289202 11:19171877-19171899 CTGAGCGCTCTGGGTAGTCGTGG + Intronic
1079837437 11:25351356-25351378 CTGAGAGCTCAGGGTAGGTTGGG + Intergenic
1081590784 11:44421644-44421666 CTGGGAGCTCTGTGAAGGCAGGG + Intergenic
1082774733 11:57236414-57236436 CTGTGAGCTCAGAGTGGGCCTGG - Exonic
1084277810 11:68064027-68064049 CTGAAAGCTCTGCATAGTCTCGG + Intronic
1088089615 11:106022372-106022394 CTGAGAGCCCGCCCTAGGCCTGG + Intronic
1090266184 11:125354299-125354321 CTGAGAGCTCTGTTTTGGACAGG - Intronic
1090548354 11:127790859-127790881 CTGGGAGCTCAGGGTAGGCAAGG + Intergenic
1091974021 12:4810541-4810563 CAGAGAGCTCTGGGCCGGCCAGG + Exonic
1092778660 12:11965488-11965510 CTGAGAGCCCTGTGTAGGAGGGG + Intergenic
1095040550 12:37435808-37435830 GTGAGAGCTCTGGGTGGGCCAGG - Intergenic
1096397226 12:51275435-51275457 CTGAGAGCTCCGAGGAGGCAGGG - Intergenic
1100243846 12:92736794-92736816 GTGAGAGCACTTCATAGGCCAGG + Intronic
1100774935 12:97963538-97963560 TTGAAAGCTCAGTGTAGGCCTGG + Intergenic
1101281996 12:103267334-103267356 TTGAGTGCTCAGTGTAGGCCAGG + Intronic
1104715467 12:131013276-131013298 CCGAGAGCTCTGCAGAGGGCTGG + Intronic
1108000045 13:45897386-45897408 CTGGGAGTTCTGGGCAGGCCAGG - Intergenic
1112001900 13:95218554-95218576 CAGAAAGTTCTCCGTAGGCCAGG + Intronic
1112253447 13:97805665-97805687 CCGTGAGCTCTGCGAAGGCTGGG + Intergenic
1112421896 13:99259942-99259964 CTGAGGGCTCTCCATAGGCCTGG + Intronic
1113634038 13:111907767-111907789 CTGGGAGCTCTGGGAAGTCCAGG + Intergenic
1117484006 14:56175433-56175455 CAGAGAGCTCTGTGAAGGCAGGG + Intronic
1121013754 14:90536111-90536133 CTGAGAGCTGACCGTGGGCCTGG - Exonic
1121951556 14:98175257-98175279 CTGAGGGCTCTCCAGAGGCCTGG - Intergenic
1122232441 14:100313479-100313501 CTGTGGGCTCTGGGCAGGCCGGG + Intergenic
1123427367 15:20183629-20183651 CTGAGAGCCTTGCGGAGGCTGGG + Intergenic
1123467943 15:20530009-20530031 CTGAGAGCTGTGGGTAGGGAAGG + Intergenic
1123536603 15:21190179-21190201 CTGAGAGCCTTGCGGAGGCTGGG + Intergenic
1123650170 15:22471033-22471055 CTGAGAGCTGTGGGTAGGGAAGG - Intergenic
1123728257 15:23125218-23125240 CTGAGAGCTGTGGGTAGGGAAGG + Intergenic
1123740576 15:23279875-23279897 CTGAGAGCTGTGGGTAGGGAAGG - Intergenic
1123746422 15:23322683-23322705 CTGAGAGCTGTGGGTAGGGAAGG + Intergenic
1124278689 15:28346000-28346022 CTGAGAGCTGTGGGTAGGGAAGG + Intergenic
1124304011 15:28565608-28565630 CTGAGAGCTGTGGGTAGGGAAGG - Intergenic
1124532892 15:30522083-30522105 CTGAGAGCTGTGGGTAGGGAAGG - Intergenic
1124765764 15:32485561-32485583 CTGAGAGCTGTGGGTAGGGAAGG + Intergenic
1125887752 15:43241246-43241268 CTGTGAGCTCTGCTTACGCCAGG + Intronic
1126426453 15:48531723-48531745 CTGAGAGCTCTTGGCAAGCCGGG - Intronic
1129769643 15:78194780-78194802 CTGCGAGCTCTGCCCAGGGCAGG - Intronic
1130433615 15:83874267-83874289 CTGGGAGCTCTGCGTGGGATGGG - Intronic
1130995085 15:88899132-88899154 CTGAGGGATCTGAGTAGGTCTGG - Exonic
1132224033 15:100126834-100126856 CTGAGAGCTCTGTGCAGGCCCGG - Intronic
1132745470 16:1434481-1434503 CTCAGGGCCCTGCGGAGGCCAGG - Exonic
1135113871 16:19710052-19710074 CTGAGAGATCTTCTCAGGCCCGG + Intronic
1135400879 16:22165660-22165682 CTGAGACCTCTCCACAGGCCTGG - Intergenic
1136070261 16:27783161-27783183 CAGAGAGCACTGCGCATGCCTGG - Intergenic
1136298804 16:29319629-29319651 CTGAGAGCTCTCCGTAGCGCAGG + Intergenic
1136428405 16:30183911-30183933 CAGAGCGCTCTGCGGAGGCGAGG + Intronic
1137701791 16:50502831-50502853 GTGGGAGCTCGGCGCAGGCCTGG - Intergenic
1139428661 16:66899448-66899470 CTGGGACCTCTGCCTATGCCTGG + Intergenic
1139639678 16:68282077-68282099 CTGAGAACTCTGACCAGGCCTGG - Intronic
1140209597 16:72959939-72959961 CGGAGAGCACCGCGTCGGCCGGG - Exonic
1140855858 16:78977227-78977249 CTGAGAGCTCTTCAAAGGCTGGG + Intronic
1141160284 16:81625184-81625206 CTGGGAGATCTGAGGAGGCCTGG + Intronic
1142060473 16:88026127-88026149 CTGAGAGCTCTCCGTAGCGCAGG + Intronic
1142501559 17:336002-336024 CTGGGCGCTGTGCCTAGGCCAGG + Intronic
1143893439 17:10119348-10119370 CTGAGTGCTCACCGTGGGCCTGG + Intronic
1144405659 17:14950474-14950496 CTGAGAGCTGTTCGTGGCCCAGG - Intergenic
1144849277 17:18235843-18235865 CAGAGAGCCCAGCGTGGGCCTGG + Intronic
1144956445 17:19021176-19021198 CTGAGAGCTCTGCTGGGCCCCGG + Exonic
1145377285 17:22362548-22362570 GTGAGAGCTCTGGGTGGGCCAGG + Intergenic
1145934145 17:28705267-28705289 GTGAGAGATCAGCGTGGGCCAGG - Intronic
1151911087 17:77083806-77083828 CTGATAGCTCTGGGTAGTGCTGG - Intergenic
1152528562 17:80903446-80903468 CTGAGAGGCCTGGGCAGGCCTGG - Intronic
1155256121 18:23999667-23999689 CTGAGAGCTGGGCTTAGGCATGG - Intronic
1158669116 18:59458738-59458760 CTGAGAGCTATCTGTCGGCCAGG + Intronic
1160005928 18:75069112-75069134 CTGTGAGCTCTGCGTGGTCGTGG + Intergenic
1160756172 19:758105-758127 CTGAGGGCTCTCCGGAGTCCGGG - Exonic
1160893313 19:1390857-1390879 CAGAGAACTCTGCGGAGGCCGGG - Exonic
1161072514 19:2269914-2269936 CCGAGAGCACTGCTAAGGCCGGG - Intronic
1165406387 19:35633704-35633726 CCGAGAGCTGGGCCTAGGCCTGG + Exonic
1165599043 19:37037247-37037269 GTGAGAGCTCTGGGTGGGCCGGG + Intronic
1168696903 19:58408808-58408830 CAGGCAGCTCTGCGTGGGCCGGG + Exonic
1202694034 1_KI270712v1_random:111848-111870 CTCAGAGCTCAGCGTGGGCGAGG + Intergenic
925367554 2:3321114-3321136 CCGAGAGCTCTCCCTGGGCCGGG - Intronic
926692325 2:15746065-15746087 CTGAGGGCTTTGCCTCGGCCTGG + Intergenic
933952527 2:87342727-87342749 CTCAGAGCTCAGCGTGGGCGAGG - Intergenic
934236773 2:90239073-90239095 CTCAGAGCTCAGCGTGGGCGAGG - Intergenic
935685896 2:105682230-105682252 CTCAGAGCTCTGTGTAGGTTTGG - Intergenic
935872853 2:107469684-107469706 CTGAGCGCTATGCGCAGCCCGGG + Intergenic
937273473 2:120669917-120669939 CTGAGATCTCTGCGCAGACCTGG - Intergenic
938391738 2:130912097-130912119 CTGAGAGGGCTGCTAAGGCCGGG - Intronic
944691725 2:202164686-202164708 CTGAGAGAACTGCGCAGGGCTGG - Intronic
948827109 2:240578160-240578182 CTGACAGCTGTGCCTAGCCCCGG + Exonic
949065695 2:241989211-241989233 CTGAGAGCTCAGCGGAGGCTGGG + Intergenic
1171572771 20:26269477-26269499 GTGAGAGCTCTGTGTGGGCCGGG + Intergenic
1171805954 20:29680471-29680493 GTGAGAGCTCTGGGTGGGCCAGG + Intergenic
1171838106 20:30175963-30175985 GTGAGAGCTCTGGGTGGACCGGG - Intergenic
1173252790 20:41373526-41373548 CGCAGAGCTCTGGGTAGCCCAGG + Intergenic
1173383658 20:42568685-42568707 CAGACAGCTCTCTGTAGGCCAGG - Intronic
1174045563 20:47730190-47730212 CTGAGAGCCCTGGCAAGGCCTGG + Intronic
1174509311 20:51039079-51039101 CTTAGAGCTTTGCGTGGGCAGGG - Intergenic
1175581518 20:60103563-60103585 CTGAGAGCCTAGAGTAGGCCCGG + Intergenic
1176187261 20:63787834-63787856 CTGAGAGATCTGCGAGAGCCGGG - Intronic
1179111747 21:38452790-38452812 CTCAGGGCTCTGAGAAGGCCTGG + Intronic
1179926805 21:44539283-44539305 CTGAGGCCTCTGCTCAGGCCAGG - Exonic
1179932518 21:44579744-44579766 CTGAGGCCTCTGCTCAGGCCAGG - Exonic
1179937104 21:44612877-44612899 CTGAGGCCTCTGCTCAGGCCAGG + Exonic
1180574494 22:16760009-16760031 GTGAGAGCTCTGGGTGGGCCGGG - Intergenic
1180855143 22:19040830-19040852 CAGAGAGCTCTGAGAAGGCCTGG - Intronic
1181622430 22:24100242-24100264 CTGTGTGCTCTGCCCAGGCCTGG + Intronic
1183688812 22:39376719-39376741 CTGAGAGCCGTGAGCAGGCCGGG + Intronic
1183828751 22:40407072-40407094 GTGAGAGCTCTGCGAGTGCCAGG + Intronic
1184604111 22:45562540-45562562 CCAAGAGCCCTGCGTAGCCCTGG + Intronic
1184820951 22:46908974-46908996 GGGAGAGATCTGCGCAGGCCGGG - Intronic
1184956925 22:47894193-47894215 CTGAGAGCTCTGCCTAAGAAAGG + Intergenic
949231562 3:1756673-1756695 CAAAGAGCTCTCCGTAGCCCTGG - Intergenic
949281459 3:2352413-2352435 CTGCGAGCGCTGCGCAGCCCTGG - Intronic
952707343 3:36392660-36392682 CTGAAAGCTCTGCAGGGGCCGGG - Intronic
953809843 3:46102876-46102898 CTGGGGTCTCTGCTTAGGCCAGG - Intergenic
954630647 3:52046071-52046093 CTGAGAGCCCTGGGAAGGCTCGG - Intergenic
955195416 3:56801396-56801418 CTGAGAGCCCTGCAAAGGCAAGG + Intronic
955350026 3:58186520-58186542 CCGGGAGCTCAGCCTAGGCCCGG - Intergenic
955520741 3:59773228-59773250 CTGTGAGCTCTGGGCAGGCAGGG - Intronic
956624585 3:71254452-71254474 CAAAGAGCTCTGCGAATGCCAGG + Intronic
957302709 3:78413385-78413407 CTGAGAGCACTGCGTTATCCTGG + Intergenic
968279013 3:197461377-197461399 CTGAGGCCTCTGAGTAGCCCTGG - Intergenic
975724514 4:77278951-77278973 CTCAGAGCTCCACGTGGGCCCGG - Intronic
980247490 4:130266671-130266693 CTGAGACCACCTCGTAGGCCTGG - Intergenic
982034982 4:151337331-151337353 CTGACAGTTCTGCCTAGGCTAGG + Intergenic
982138131 4:152292225-152292247 CTGTGACCTCTGAGTAGGCAAGG + Intergenic
982537458 4:156624965-156624987 CTTAGAGCTCTGCATAGGGATGG - Intergenic
985034334 4:185822810-185822832 CTGAGAGTTCTGAGAACGCCGGG + Intronic
985553796 5:546356-546378 CTGGGAGCCCTGGGAAGGCCCGG + Intergenic
990464039 5:56055482-56055504 CTGAGGGCTCAGCATAGGTCTGG + Intergenic
997513231 5:134466945-134466967 CCGAGAGCTCTTCATTGGCCAGG + Intergenic
1001382907 5:171315639-171315661 CTGAGGGCTCTGATTCGGCCAGG - Intergenic
1002067025 5:176656986-176657008 CCCAGAGGCCTGCGTAGGCCAGG - Intronic
1002415956 5:179121169-179121191 CTGTGAGCTGCGCGAAGGCCGGG + Intronic
1002519850 5:179786362-179786384 CTGGGAGCTGGGCCTAGGCCAGG - Intronic
1003258734 6:4496802-4496824 CTGTGAGCTCCTCGAAGGCCAGG - Intergenic
1004204001 6:13574694-13574716 CTAAGAGCTCTGGGTACCCCCGG - Exonic
1006368495 6:33630296-33630318 CAGAGAGCTCTGCGGAGGTTTGG + Intronic
1006919600 6:37618795-37618817 CTGGGAGTTCTGTGTTGGCCAGG - Intergenic
1010107105 6:72182760-72182782 CTGAGAGAACTGCGGAGACCAGG + Exonic
1011314520 6:86016779-86016801 CTGGGAGCTCTGCACAGACCAGG + Intergenic
1018765863 6:166932312-166932334 CGCTGAGCTCTGAGTAGGCCGGG - Intronic
1019434422 7:1014842-1014864 CTGAGAGCTGGGCTCAGGCCGGG - Intronic
1019537489 7:1536935-1536957 CTGGGAGCCCTGCGTCCGCCAGG + Intronic
1024527995 7:50365125-50365147 CTGGGAGCTCTGTGGATGCCAGG - Intronic
1025286599 7:57667442-57667464 GTGAGAGCTCTGGGTGGGCCAGG - Intergenic
1025299467 7:57806585-57806607 GTGAGAGCTCTGGGTGGGCCAGG + Intergenic
1026866846 7:73829428-73829450 CTGGGAGCTCTGCAGGGGCCAGG - Exonic
1028511703 7:91632374-91632396 GTGAGAGCTGTGGGTAGGCTGGG - Intergenic
1032677533 7:134145183-134145205 CTGTGAGCTCTGTGTAGACCTGG + Intronic
1037410193 8:18587754-18587776 TTGTGAGCTCTGTGTAGGCAGGG + Intronic
1038037161 8:23696259-23696281 CAGAGGGCTCTGCGATGGCCTGG + Intergenic
1044930421 8:97246824-97246846 ATGAGATCTCTGCACAGGCCAGG + Intergenic
1053057103 9:34999794-34999816 CTGCGGGCTCTGCCTAGCCCTGG + Intergenic
1055391567 9:75827404-75827426 CTGAGAGCTCTCATTAGGCCAGG + Intergenic
1056194818 9:84219101-84219123 CTGAGAGCCCTGAGCAGGCAAGG + Intergenic
1056475437 9:86947356-86947378 CCCGGAGCTCTGCGGAGGCCGGG - Intergenic
1060552822 9:124493665-124493687 CTGAGAGCTCTGCGTAGGCCCGG - Intronic
1060730455 9:126033744-126033766 CTGAGAGCTGTGGGGAGCCCCGG - Intergenic
1061264625 9:129497808-129497830 CTGCGACCTCTGCGGAGGCCAGG - Intergenic
1061945699 9:133907284-133907306 CTGAGGGCTCTGAGCTGGCCTGG - Intronic
1061994011 9:134174981-134175003 CTGAGAGGTCTGAGTAGGGCGGG + Intergenic
1062198799 9:135289754-135289776 CTGAGGCCTCTGTGTTGGCCAGG + Intergenic
1187237518 X:17482174-17482196 CTAAGTGCTTTGAGTAGGCCAGG + Intronic
1191087829 X:56588118-56588140 CTGAGATCCCTGCTTAGCCCTGG + Intergenic
1196828042 X:119756453-119756475 CTGAGAAGTCAGCGAAGGCCAGG + Intergenic