ID: 1060552826

View in Genome Browser
Species Human (GRCh38)
Location 9:124493675-124493697
Sequence GCAGAGCTCTCAGGCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060552819_1060552826 -10 Left 1060552819 9:124493662-124493684 CCCCCGGGCCTACGCAGAGCTCT 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1060552826 9:124493675-124493697 GCAGAGCTCTCAGGCTCAGGAGG No data
1060552816_1060552826 2 Left 1060552816 9:124493650-124493672 CCAAGGGCTTCCCCCCCGGGCCT 0: 1
1: 0
2: 6
3: 28
4: 268
Right 1060552826 9:124493675-124493697 GCAGAGCTCTCAGGCTCAGGAGG No data
1060552813_1060552826 16 Left 1060552813 9:124493636-124493658 CCATGAGGGAGAAACCAAGGGCT 0: 1
1: 0
2: 0
3: 20
4: 210
Right 1060552826 9:124493675-124493697 GCAGAGCTCTCAGGCTCAGGAGG No data
1060552817_1060552826 -8 Left 1060552817 9:124493660-124493682 CCCCCCCGGGCCTACGCAGAGCT 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1060552826 9:124493675-124493697 GCAGAGCTCTCAGGCTCAGGAGG No data
1060552818_1060552826 -9 Left 1060552818 9:124493661-124493683 CCCCCCGGGCCTACGCAGAGCTC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1060552826 9:124493675-124493697 GCAGAGCTCTCAGGCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060552826 Original CRISPR GCAGAGCTCTCAGGCTCAGG AGG Intronic
No off target data available for this crispr