ID: 1060552838

View in Genome Browser
Species Human (GRCh38)
Location 9:124493714-124493736
Sequence CTGGCCTGAGGTCAGGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060552819_1060552838 29 Left 1060552819 9:124493662-124493684 CCCCCGGGCCTACGCAGAGCTCT 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1060552838 9:124493714-124493736 CTGGCCTGAGGTCAGGCCCAGGG No data
1060552820_1060552838 28 Left 1060552820 9:124493663-124493685 CCCCGGGCCTACGCAGAGCTCTC 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1060552838 9:124493714-124493736 CTGGCCTGAGGTCAGGCCCAGGG No data
1060552818_1060552838 30 Left 1060552818 9:124493661-124493683 CCCCCCGGGCCTACGCAGAGCTC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1060552838 9:124493714-124493736 CTGGCCTGAGGTCAGGCCCAGGG No data
1060552821_1060552838 27 Left 1060552821 9:124493664-124493686 CCCGGGCCTACGCAGAGCTCTCA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 1060552838 9:124493714-124493736 CTGGCCTGAGGTCAGGCCCAGGG No data
1060552824_1060552838 21 Left 1060552824 9:124493670-124493692 CCTACGCAGAGCTCTCAGGCTCA 0: 1
1: 0
2: 0
3: 9
4: 217
Right 1060552838 9:124493714-124493736 CTGGCCTGAGGTCAGGCCCAGGG No data
1060552822_1060552838 26 Left 1060552822 9:124493665-124493687 CCGGGCCTACGCAGAGCTCTCAG 0: 1
1: 0
2: 1
3: 21
4: 161
Right 1060552838 9:124493714-124493736 CTGGCCTGAGGTCAGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060552838 Original CRISPR CTGGCCTGAGGTCAGGCCCA GGG Intronic
No off target data available for this crispr