ID: 1060557614

View in Genome Browser
Species Human (GRCh38)
Location 9:124517082-124517104
Sequence TTGGGCACTTCAGTCAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060557609_1060557614 10 Left 1060557609 9:124517049-124517071 CCTTGAAGTTCAATATGGTGCCT No data
Right 1060557614 9:124517082-124517104 TTGGGCACTTCAGTCAGTGCTGG 0: 1
1: 0
2: 2
3: 20
4: 147
1060557613_1060557614 -10 Left 1060557613 9:124517069-124517091 CCTGGCACACAAGTTGGGCACTT 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1060557614 9:124517082-124517104 TTGGGCACTTCAGTCAGTGCTGG 0: 1
1: 0
2: 2
3: 20
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060557614 Original CRISPR TTGGGCACTTCAGTCAGTGC TGG Intergenic
906586483 1:46983532-46983554 CTGAGCACTTCAGTCAGTGGCGG - Intergenic
913384964 1:118249623-118249645 TCGGGCACTACATTAAGTGCTGG + Intergenic
917922910 1:179765865-179765887 TTGGGGACTTCTGTCATTTCAGG - Intronic
918876480 1:190051960-190051982 TTGGGAACTTCATTCATTGCTGG - Intergenic
919066040 1:192693730-192693752 TTGGCCACTTTAGTCACAGCTGG + Intergenic
920245257 1:204582994-204583016 TTGAGCACTCCAGTTAGTGCAGG - Intergenic
1063331564 10:5164821-5164843 TTGGGAACTGGAGTTAGTGCAGG - Intergenic
1065473154 10:26103805-26103827 TTGGAACCTTCAGACAGTGCTGG - Intronic
1066624799 10:37395658-37395680 CTGGTCACTTCAGTGAGTGTTGG + Intergenic
1069132270 10:64720833-64720855 TCAGGCTCTTCAGTAAGTGCTGG + Intergenic
1073447058 10:103587934-103587956 TTGGGCACTTAGGTGTGTGCAGG + Intronic
1073717351 10:106122239-106122261 TTGGGCAGTGCAGACAATGCTGG - Intergenic
1077193947 11:1269984-1270006 CTGGGCACATCAACCAGTGCTGG - Intergenic
1077555139 11:3222357-3222379 TTGGGCACTTCAAACAGTGCTGG + Intergenic
1078506757 11:11956285-11956307 TAGGGCAGTCCAATCAGTGCTGG - Exonic
1079330024 11:19525628-19525650 GTGGGCACTTCTCTCAGTGAGGG + Intronic
1079622071 11:22567261-22567283 CTGAACACTTCAGTCAGTGGTGG - Intergenic
1079735696 11:23994300-23994322 CTGATCACTTCAGTCAGTGATGG + Intergenic
1081578892 11:44338280-44338302 TTGGGCAATTCAAATAGTGCTGG - Intergenic
1085238716 11:75034359-75034381 TTGGGAACTTCAGCAAGGGCAGG - Intergenic
1087461030 11:98447587-98447609 TTGAGCACTTCAGACACTTCAGG - Intergenic
1088823096 11:113473501-113473523 CTGGGCACCTCAGGCTGTGCAGG + Intronic
1089281123 11:117375253-117375275 TTGGGCTTTGGAGTCAGTGCGGG + Intronic
1091401178 12:181720-181742 TTGGCCACATCTGTCAGAGCTGG - Intergenic
1091422477 12:354110-354132 TTGGGCACATCAGGTAGTGGAGG + Exonic
1093573901 12:20702686-20702708 TTTGGCCCTTCACTCAGTGCAGG - Intronic
1099328284 12:81247793-81247815 TTGGGCACTTTAATAAGAGCTGG - Intronic
1100433126 12:94548019-94548041 TTGAGCAGTTGAGTCAATGCTGG - Intergenic
1103370571 12:120416168-120416190 TTGTACACTATAGTCAGTGCAGG - Intergenic
1105256658 13:18747828-18747850 TTGGACATTTCAGTAAATGCTGG - Intergenic
1105258003 13:18757571-18757593 TTGGACATTTCAGTAAATGCTGG - Intergenic
1105262007 13:18786503-18786525 TTGGGAACTTGAGTAAATGCTGG - Intergenic
1105262953 13:18793281-18793303 TTGGACATTTCAGTAAATGCTGG - Intergenic
1105264371 13:18803091-18803113 TTGGGCATTTGAGTAAATGCTGG - Intergenic
1108501355 13:51072469-51072491 GTGGGGAGTTCAGTCAGTGGAGG - Intergenic
1110529521 13:76579965-76579987 TCGGGCTCATCAGTCAGTCCTGG + Intergenic
1111421735 13:88019574-88019596 TTGGGCTTTTGAGTCAATGCTGG + Intergenic
1112301391 13:98233795-98233817 TTGGTGACTTCTGCCAGTGCAGG + Intronic
1116364171 14:44039578-44039600 TTGGACTTTTTAGTCAGTGCTGG + Intergenic
1117913570 14:60655851-60655873 TTGGGAACTTCAGGCACTGCTGG - Intronic
1117988043 14:61407916-61407938 TTGAGCTCTTCAGACAGGGCAGG + Intronic
1118247835 14:64128954-64128976 TTCAGCACTTCAAACAGTGCTGG - Intronic
1121599848 14:95195273-95195295 CTGGGCTCTGCTGTCAGTGCAGG - Intronic
1122593505 14:102872311-102872333 TGGGTCACTTCCGTCATTGCAGG + Intronic
1126007403 15:44271210-44271232 TTGGACAGTTCTATCAGTGCTGG - Intergenic
1131286895 15:91067022-91067044 GTGGGCACTGGAGTCAATGCAGG + Intergenic
1132150829 15:99457086-99457108 TTGGGCATTCCAGTGGGTGCTGG - Intergenic
1136746643 16:32597031-32597053 GTGTGCCCTTCAGTCTGTGCTGG + Intergenic
1136872399 16:33819600-33819622 TTGGACTTTTGAGTCAGTGCTGG - Intergenic
1138899083 16:61246393-61246415 TTGGGCACTTCAGTTAATCCAGG + Intergenic
1141814765 16:86402114-86402136 TTGGGCCCTTCAGCCTGTTCTGG - Intergenic
1142014322 16:87736168-87736190 TTGGGCTCTCCCGTCAGTGCAGG - Intronic
1203048772 16_KI270728v1_random:856235-856257 GTGTGCCCTTCAGTCTGTGCTGG + Intergenic
1203099773 16_KI270728v1_random:1296468-1296490 TTGGACTTTTGAGTCAGTGCTGG + Intergenic
1154425357 18:14267914-14267936 TTGGACATTTCAGTAAATGCTGG + Intergenic
1154428085 18:14287501-14287523 TTGGACATTTCAGTAAATGCTGG + Intergenic
1154428501 18:14290425-14290447 TTGGACATTTCAGTAAATGCTGG + Intergenic
1154430779 18:14306848-14306870 TTGGACATTTCAGTAAATGCTGG + Intergenic
1154433448 18:14326073-14326095 TTGGACATTTTAGTAAGTGCTGG + Intergenic
1154434389 18:14332853-14332875 TTGGGCATTTCAGTAAATGCTGG + Intergenic
1156392049 18:36659913-36659935 AGGGGCACTTCAGCCAGTCCAGG - Intronic
1158091992 18:53725842-53725864 TTGGGAACTACAGTCAGGACTGG - Intergenic
1166536067 19:43575547-43575569 TTGCGCACTTTAGCCAGCGCAGG - Exonic
928377209 2:30785178-30785200 CTAGGCACTTAAGTCAGTGGGGG + Intronic
930599221 2:53424520-53424542 CTGAGCACATCAGTCAGTGGCGG - Intergenic
932442215 2:71744683-71744705 CTGGGCATTTCAGACACTGCAGG + Intergenic
932632439 2:73356939-73356961 TTGGAAACTTCACACAGTGCTGG + Intergenic
934036681 2:88094197-88094219 TGGTGCACTTGAGTCTGTGCTGG + Intronic
934149833 2:89135723-89135745 TTGGGCAGTGAAGTCAGGGCAGG + Intergenic
934217465 2:90046308-90046330 TTGGGCAGTGAAGTCAGGGCAGG - Intergenic
934494058 2:94782231-94782253 TTGGACATTTCAGTAAATGCTGG - Intergenic
934992673 2:98932657-98932679 CTGGAGACTTCAGTCAGGGCTGG - Intronic
936036628 2:109118068-109118090 TTGTGCCTTGCAGTCAGTGCTGG - Intergenic
937117679 2:119420280-119420302 TTGGACTTTTGAGTCAGTGCTGG - Intergenic
937693801 2:124785645-124785667 TGGTGCACTGAAGTCAGTGCAGG + Intronic
937856642 2:126676824-126676846 ATGGGCACTTGAGCCAGGGCAGG + Intronic
937926836 2:127174346-127174368 TTGGACATCTCAGGCAGTGCTGG - Intergenic
940581359 2:155584524-155584546 CTGATCACTTCAGTCAGTGGAGG + Intergenic
941169329 2:162118230-162118252 TTGGGCAAGTGAGTCAGTGTGGG + Intergenic
943440565 2:187922756-187922778 TTGGTCTGTTCAGTCAGTGGAGG - Intergenic
944386138 2:199167112-199167134 TTATGCACTTCACTCTGTGCAGG - Intergenic
945172253 2:207008887-207008909 GTGGGCACTGCAGTCACTGATGG + Intergenic
945913915 2:215682536-215682558 TTGGCCACTTTAGTCTGTGGTGG + Intergenic
948380030 2:237544631-237544653 TTGGGCACTGTAGTGAGTGGGGG + Intronic
1171233004 20:23502192-23502214 CTGGACATTTCAGTAAGTGCTGG - Intergenic
1171285946 20:23938178-23938200 TGGGGCAGTGCTGTCAGTGCTGG + Intergenic
1171883809 20:30637019-30637041 TTGGGCATTTCAGTAAATGCTGG - Intergenic
1174858403 20:54068114-54068136 TTGGGCAGTTCAGTGAGGACTGG - Intronic
1175792896 20:61753436-61753458 GTGGGCAATGCAGGCAGTGCTGG + Intronic
1176842648 21:13852864-13852886 TTGGGCATTTCAGTAAATGCTGG - Intergenic
1176843994 21:13862601-13862623 TTGGACATTTCAGTAAATGCTGG - Intergenic
1176845341 21:13872211-13872233 TTGGGCATTTGAGTAAATGCTGG - Intergenic
1176846268 21:13878997-13879019 TTGGACATTTCAGTAAATGCTGG - Intergenic
1176846681 21:13881922-13881944 TTGGACATTTCAGTAAATGCTGG - Intergenic
1176848068 21:13891768-13891790 TTGGGCACTTGAATAAATGCTGG - Intergenic
1176849003 21:13898539-13898561 TTGGACATTTCAGTAAATGCTGG - Intergenic
1176849446 21:13901529-13901551 TTGGGCATTTGAGTAAATGCTGG - Intergenic
1177649213 21:23938980-23939002 TTGGGAACTTCAGTCATTAAAGG - Intergenic
1182773775 22:32816014-32816036 CTGGGCCCTTCAATCAGTGCTGG - Intronic
1183829323 22:40409550-40409572 TTGGGCAGCTCCATCAGTGCAGG - Intronic
950002726 3:9669481-9669503 CTGTGCTCTTCGGTCAGTGCTGG + Exonic
950297965 3:11848235-11848257 ATGGGAACGTCAGTCAGTTCTGG + Intergenic
951602243 3:24389223-24389245 TTGGGGACTTCAGTCAGTAAAGG - Intronic
953028202 3:39157325-39157347 TTGGGCACTTGAGTTAGTGAGGG + Intergenic
955792610 3:62604207-62604229 ATGGCCACTGAAGTCAGTGCAGG - Intronic
956669515 3:71673106-71673128 TTGGGAACTCCACTAAGTGCAGG - Intergenic
960049478 3:113226320-113226342 TGGGGTGCTTCAGCCAGTGCTGG + Intronic
963323771 3:143838345-143838367 ATGGGCACTTAGGGCAGTGCAGG + Intronic
966348486 3:179004512-179004534 TAGGGCAACTAAGTCAGTGCTGG + Intergenic
966914482 3:184577339-184577361 GTGGGCACTTCAGACGGGGCTGG - Exonic
968865731 4:3210051-3210073 TTGGGGACTCCAGTCTGGGCAGG + Intronic
971727094 4:30327982-30328004 CTGAACACTTCAGTCAGTGGTGG - Intergenic
973271239 4:48265064-48265086 TTGGGAAATTCAATCTGTGCAGG + Intronic
973367466 4:49219289-49219311 TTGGACACTTCAGTAAATGCTGG - Intergenic
974007529 4:56573749-56573771 TTGGGCAGTAGAGTCAGGGCTGG + Intronic
979597847 4:122554432-122554454 TTGGCCAGTCCAGTCTGTGCAGG - Intergenic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
984704226 4:182836021-182836043 CTGGGCACTTCTGTAAGTGCTGG + Intergenic
990308908 5:54519077-54519099 TGGGGCACGTCAGGAAGTGCTGG - Exonic
991317800 5:65329675-65329697 TTTTGAACTGCAGTCAGTGCTGG + Intronic
993267417 5:85744060-85744082 TTGAGCACTTCAGTCAGCTGTGG + Intergenic
995891304 5:116955245-116955267 TTGGGCACAGCAATCTGTGCTGG - Intergenic
996926104 5:128828472-128828494 TTCTGCACTGCAGGCAGTGCAGG + Intronic
999054916 5:148564179-148564201 TTGGGCACTTCATTTAGTGTTGG - Intronic
1002333350 5:178460850-178460872 CTGTGGTCTTCAGTCAGTGCGGG + Intronic
1003007759 6:2397544-2397566 GTGGGCAGTTCAGTCGTTGCAGG + Intergenic
1006604094 6:35243941-35243963 TTGGGCCCTTGATTCATTGCAGG + Exonic
1007072955 6:39049640-39049662 TTGGGGCCTGCTGTCAGTGCAGG - Intronic
1007975169 6:46094341-46094363 TTGGGCTTTTGAGTTAGTGCTGG - Intergenic
1008321326 6:50117815-50117837 TTTAGCACTTCAGACAATGCAGG - Intergenic
1016005044 6:139080485-139080507 TTTGCCATTTCAGTCAATGCTGG - Intergenic
1017558069 6:155594951-155594973 TTGGCCTCTTCATTCATTGCTGG + Intergenic
1017849576 6:158293412-158293434 TTGAACACTTAATTCAGTGCAGG + Intronic
1019606991 7:1914920-1914942 TTGAGTAACTCAGTCAGTGCTGG + Intronic
1020003148 7:4766893-4766915 TTGGGCGATTCAGTGAGTTCAGG + Exonic
1022455027 7:30551194-30551216 TTGCACACGTCAGTCAGGGCTGG + Intronic
1023851836 7:44154641-44154663 TTGGGCATTTCACCCAGTTCTGG + Intronic
1023875303 7:44283382-44283404 CTGGGCACTGCAGGCAGTGATGG - Intronic
1024355053 7:48405887-48405909 TTTTGCACTTCAGTCAGTGCAGG - Intronic
1031472353 7:122182264-122182286 CTGGGCACTTAAGGAAGTGCTGG + Intergenic
1032134457 7:129262777-129262799 ATGGTCACTTCAGTCAGTTGGGG + Intronic
1038870910 8:31491307-31491329 TGGGGCTCGTCAGTCAGTGGGGG - Intergenic
1042427561 8:68665920-68665942 TTGGGCACTGTCCTCAGTGCTGG - Intronic
1045397644 8:101776888-101776910 TTTGCCAGTTCAGTGAGTGCAGG - Intronic
1046031713 8:108789912-108789934 GTGGGTACTTCAGTCTCTGCAGG + Intergenic
1047108746 8:121764926-121764948 ATGGGCACTTCATTCTGAGCTGG + Intergenic
1048738924 8:137532514-137532536 TTGGACATTTCAGTTAATGCTGG + Intergenic
1053607869 9:39679236-39679258 CTGAGCACTTCAGTCAGTGGTGG + Intergenic
1053664016 9:40304894-40304916 TTGGACATTTCAGTAAATGCTGG + Intronic
1053664982 9:40311100-40311122 TTGGACATTTCAGTAAATGCTGG + Intronic
1053666291 9:40320207-40320229 TTGGACATTTCAGTAAATGCTGG + Intronic
1053865715 9:42435596-42435618 CTGAGCACTTCAGTCAGTGGTGG + Intergenic
1053914561 9:42936150-42936172 TTGGACATTTCAGTAAATGCTGG + Intergenic
1053915871 9:42945254-42945276 TTGGACATTTCAGTAAATGCTGG + Intergenic
1054245665 9:62663173-62663195 CTGAGCACTTCAGTCAGTGGTGG - Intergenic
1054376144 9:64451128-64451150 TTGGACATTTCAGTAAATGCTGG + Intergenic
1054377444 9:64460235-64460257 TTGGACATTTCAGTAAATGCTGG + Intergenic
1054518318 9:66056076-66056098 TTGGACATTTCAGTAAATGCTGG - Intergenic
1054519633 9:66065184-66065206 TTGGACATTTCAGTAAATGCTGG - Intergenic
1054520598 9:66071391-66071413 TTGGACATTTCAGTAAATGCTGG - Intergenic
1054559791 9:66697704-66697726 CTGAGCACTTCAGTCAGTGGTGG - Intergenic
1057975278 9:99599474-99599496 TTGGGCAATTCTGTCATTGTGGG - Intergenic
1058756531 9:108087921-108087943 TTGTTCACTCCAGTCTGTGCAGG - Intergenic
1059806261 9:117803977-117803999 ATGGGCACATTAGTCAGTTCAGG - Intergenic
1060439746 9:123627389-123627411 TTAGGCACTGCACTAAGTGCTGG - Intronic
1060557614 9:124517082-124517104 TTGGGCACTTCAGTCAGTGCTGG + Intergenic
1186062886 X:5729946-5729968 TTGGGCATTTGAGTTAATGCTGG - Intergenic
1191083290 X:56537247-56537269 TGAGGCATTTAAGTCAGTGCTGG + Intergenic
1194457677 X:94124391-94124413 TAGGACACTTCAGTCTGTGGTGG + Intergenic
1198749747 X:139927215-139927237 CTGGGCACTGCAGTCAATCCTGG - Intronic